{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}


Ch04_Motifs-1 - www.bioalgorithms.info An Introduction to...

Info iconThis preview shows pages 1–6. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: www.bioalgorithms.info An Introduction to Bioinformatics Algorithms Finding Regulatory Motifs in DNA Sequences An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Outline • Implanting Patterns in Random Text • Gene Regulation • Regulatory Motifs • The Gold Bug Problem • The Motif Finding Problem • Brute Force Motif Finding • The Median String Problem • Search Trees • Branch-and-Bound Motif Search • Branch-and-Bound Median String Search • Consensus and Pattern Branching: Greedy Motif Search • PMS: Exhaustive Motif Search An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Random Sample atgaccgggatactgataccgtatttggcctaggcgtacacattagataaacgtatgaagtacgttagactcg gcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatactgggca taaggtaca tgagtatccctgggatgacttttgggaacactatagtgctctcccgatttttgaatatgtaggatcattcgcc agggtccga gctgagaattggatgaccttgtaagtgttttccacgcaatcgcgaaccaacgcggacccaaaggcaagaccga taaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatggcccacttagtc cacttatag gtcaatcatgttcttgtgaatggatttttaactgagggcatagaccgcttggcgcacccaaattcagtgtggg cgagcgcaa cggttttggcccttgttagaggcccccgtactgatggaaactttcaattatgagagagctaatctatcgcgtg cgtgttcat aacttgagttggtttcgaaaatgctctggggcacatacaagaggagtcttccttatcagttaatgctgtatga cactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatttcaacgtatgccgaaccg aaagggaag An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Implanting Motif AAAAAAAGGGGGGG atgaccgggatactgat AAAAAAAAGGGGGGG ggcgtacacattagataaacgtatgaagtacgttagactcg gcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaata AAAAAAA AGGGGGGG a tgagtatccctgggatgactt AAAAAAAAGGGGGGG tgctctcccgatttttgaatatgtaggatcattcgcc agggtccga gctgagaattggatg AAAAAAAAGGGGGGG tccacgcaatcgcgaaccaacgcggacccaaaggcaagaccga taaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaat AAAAAAAAGGGGG GG cttatag gtcaatcatgttcttgtgaatggattt AAAAAAAAGGGGGGG gaccgcttggcgcacccaaattcagtgtggg cgagcgcaa cggttttggcccttgttagaggcccccgt AAAAAAAAGGGGGGG caattatgagagagctaatctatcgcgtg cgtgttcat aacttgagtt AAAAAAAAGGGGGGG ctggggcacatacaagaggagtcttccttatcagttaatgctgtatga cactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcat AAAAAAAAGGGGGGG accg aaagggaag An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Where is the Implanted Motif? atgaccgggatactgataaaaaaaagggggggggcgtacacattagataaacgtatgaagtacgttagactcg gcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaataaaaaaaa aggggggga tgagtatccctgggatgacttaaaaaaaagggggggtgctctcccgatttttgaatatgtaggatcattcgcc agggtccga gctgagaattggatgaaaaaaaagggggggtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccga taaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaataaaaaaaaggggg ggcttatag gtcaatcatgttcttgtgaatggatttaaaaaaaaggggggggaccgcttggcgcacccaaattcagtgtggg cgagcgcaa cggttttggcccttgttagaggcccccgtaaaaaaaagggggggcaattatgagagagctaatctatcgcgtg cgtgttcat aacttgagttaaaaaaaagggggggctggggcacatacaagaggagtcttccttatcagttaatgctgtatga...
View Full Document

{[ snackBarMessage ]}

Page1 / 117

Ch04_Motifs-1 - www.bioalgorithms.info An Introduction to...

This preview shows document pages 1 - 6. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online