SeqAlignment

SeqAlignment - 02/10/12 1 Sequence Alignment 02/10/12 2...

Info iconThis preview shows pages 1–8. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 02/10/12 1 Sequence Alignment 02/10/12 2 Motivation: Types Two sequences of same length, some characters are different ( Database search) Aagtacggaga aagcaccgaga Two seq are of different length, possible gaps in one of them ( Database search) Aaccaccgaga Aa-caccgaga 02/10/12 3 Motivation: Types Match longest prefix of one with the suffix of the other ( fragment assembly) Aaacgtcgata gatacgatg Local alignment: longest substring matching over two sequences ( homolog search) Gatacgatgctagtttacg agagcgatgcataattcgaatga 02/10/12 4 Motivation: Types Multiple sequence alignment (page 71) ( Comparative studies of sequences) 02/10/12 5 Formalizing sequence comparison Either a character matches with the corresponding character in an an alignment (+1), Or, it does not (-1), Or, a gap needs to be inserted (-2) 02/10/12 6 Global Alignment Smith-Waterman (1981) Dynamic programming algorithm Scoring matrix for alignment ( p 31) Initializing boundaries of the scoring matrix for gaps in front of either string Meaning of an entry to the matrix Corner element is the final score 02/10/12 7 Global Alignment Three alternatives in each iteration Ordering of calculation: row or column- wise The algorithm (p 52) Recursive recovery process from corner element (constant m and n, the string lengths) Variable len returned by the algorithm Convention for tie braking 02/10/12...
View Full Document

This note was uploaded on 02/10/2012 for the course CSE 5615 taught by Professor Mitra during the Fall '11 term at FIT.

Page1 / 25

SeqAlignment - 02/10/12 1 Sequence Alignment 02/10/12 2...

This preview shows document pages 1 - 8. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online