{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Lecture 8 LC710- 1st + 2nd hr

Lecture 8 LC710- 1st + 2nd hr - Hybridization of Nucleic...

Info iconThis preview shows pages 1–9. Sign up to view the full content.

View Full Document Right Arrow Icon
Hybridization of Nucleic Acids RNA DNA1 DNA2 Probe Southern hybridization Northern hybridization Juang RH (2004) BCbasics
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Preparation of Traditional Nucleic Acid Probe Amino acid sequence GLY-ASP-GLU-SER-SER-VAL-LEU----- GGG-GAC-GAG-TCC-TCC-GTT-CTC--- Nucleic acid sequence * Codon degeneracy * * * * * * * Synthesizing oligonucleotide PROBE: GGGGACGAGTCCTCCGTTCT PROBE: GGGGACGAGTCCTCCGTTCT The nucleic acid sequence is Deduced from amino acid sequence Chemical synthesis Juang RH (2004) BCbasics
Background image of page 2
G G A T C C A T C C C C TG C T C A G G A G GCA A G A G G C A T P 32 Target gene DNA denaturation Single colony Lysed Hybridization Probe is labeled with radioactive 32 P Juang RH (2004) BCbasics
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Colony Is Screened by Hybridization with Probe Cover with filter paper Autoradiography Add probe Transferring … Collect filter paper Dissolve cell DNA denatured Juang RH (2004) BCbasics Colony hybridization
Background image of page 4
Sample DNA Each spot contains known DNA Biochip Schena (2000) Microarray Biochip Technology, p. A31 Complementary DNA hybridize Signal appears Biochip Based on Hybridization Juang RH (2004) BCbasics
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
The Genetic Code Initiation and termination Codons Initiation codon: AUG Termination codons: UAA, UAG, UGA Degeneracy: partial and complete Ordered Nearly Universal (exceptions: mitochondria and some protozoa)
Background image of page 6
Key Points Each of the 20 amino acids in proteins is specified by one or more nucleotide triplets in mRNA. (20 amino acids refers to what is attached to the tRNAs!) Of the 64 possible triplets, given the four bases in mRNA, 61 specify amino acids and 3 signal chain termination. (have no tRNAs!)
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Key Points The code is nonoverlapping, with each nucleotide part of a single codon, degenerate, with most amino
Background image of page 8
Image of page 9
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 44

Lecture 8 LC710- 1st + 2nd hr - Hybridization of Nucleic...

This preview shows document pages 1 - 9. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online