Quiz4 Fall 2011

Quiz4 Fall 2011 - Neanderthal cDNA library. Underline open...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Genetic Code Probabilities for Gorilla (1) and Human (2). 1 2 1 2 1 2 1 2 Quiz#4 LC710 11/14/11 name___________ Given the following full length cDNA for a highly expressed protein: 5’-ATCGATGCACTAGGGCCACCATGAGCAGCAACGGCGAGGACGCCGCCGAC AGCCACACCCCCGCCTGAAGAAGAAGCTGGAGAAGGAGTTCCACACGAAT CATTATCTGACCCGCAGACGGAGAATCGTTATGGCGCACGCGCTATGCCT GACGGAGCGGCAGATCAAGATCTGGTTCCAGAACCGGCGAATGAAGCTGA AGAAGGAGATCCAGTAAGCACACTAAGGCCAATAAACGTGGCCAGCAAGC ATTTAAAAAAAAAAAAAAAAAAAAAAAAAA-3’ This clone was identified from a
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Neanderthal cDNA library. Underline open reading frame (1pt) Translate open reading frame (2pts-single letter code) _____________________________ Does the sequence similarity make it more Gorilla or Human-like? (3pts) Is this clone likely to be a contaminate? (2pt) Yes or No (circle one)? Why or Why not? Extra Credit: On the sequence above Identify three salient features of this cDNA, other than Start and Stop codons (1pt)...
View Full Document

Ask a homework question - tutors are online