Quiz4 - Genetic Code: Oligo 1: 5- 3 Oligo 2: 5- 3 (1pt)...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Quiz#4 LC710 10/04/10 name___________ Q1: Given the following “sense strand” sequence to the Ubx homeodomain: Q2: You have identified the 61aa UBX conserved HOMEDOMAIN protein sequence: 5’-cgaagacgcggccgacagacatacacccgctaccagacgctcgagctgga gaaggagttccacacgaatcattatctgacccgcagacggagaatcgaga tggcgcacgcgctatgcctgacggagcggcagatcaagatctggttccag aaccggcgaatgaagctgaagaaggagatccag-3’ _____________________________________________________ Design a 5’ and 3’ oligo so that you can amplify this sequence by PCR for future cloning. Nt-RRRGRQTYTRYQTLELEKEFHTNHYLTRRRRIEMAHALCLTERQIKIWFQNRRMKLKKEIQ-Ct Oligo 1: 5’- 3’ Oligo 2: 5’- 3’ (1pt) (1pt) Design a 5’ and 3’ oligo from the ends so that you can amplify it by PCR from ANY other organisms.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Genetic Code: Oligo 1: 5- 3 Oligo 2: 5- 3 (1pt) (1pt) Q3: Given the following protein alignment for part of the UBX protein from 7 species: Oligo 1: 5- 3 Oligo 2: 5- 3 _ Using consensus amino acid sequence: Design a 5 and 3 oligo so that you can amplify some of this homology region from species # 1 . Genetic Code: 1 2 1 2 1 2 1 2 _____________________________________ Make Consensus (1pt) Add 5 EcoR1 site Add 5 BamHI site 1pt extra credit if you choose your oligos wisely! EcoR1 : GAATTC BamHI : GGATCC X =a non consensus amino acid (1pt) (1pt)...
View Full Document

Page1 / 2

Quiz4 - Genetic Code: Oligo 1: 5- 3 Oligo 2: 5- 3 (1pt)...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online