Quiz6 - MMMMM WWWWW When written out by its codons then...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Quiz#6 LC710 10/13/10 name___________ Q1 (1pt) : Given the following sequence: Write Complement 5’- AGCTAGCTTTTTTAGCTAGCT -3’ X’-_________________________Y’ If this were double stranded DNA then X is _ Y is _ Is the sequence in red a palindrome? Yes or No (circle one) Q2 (1pt) : Given the following sequence: Write Complement 5’- AGCTAGCTTAATAGCTAGCT -3’ X’-_________________________Y’ Is the sequence in red a palindrome? Yes or No (circle one) Q3 (1pt) : Given the following sequence: Write Complement 5’- AGCTAGCTTATAAGCTAGCT -3’ X’-_________________________Y’ Is the sequence in red a palindrome? Yes or No (circle one)
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Q4: Given the following amino acid sequence:
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: MMMMM WWWWW When written out by its codons, then will that sequence be a palindrome? (1pt) Yes or No (circle one) When written out by its codon usage from species # 1 below, then will It be a palindrome? (1pt) Yes or No (circle one) Genetic Code From 1 2 : 1 2 1 2 1 2 1 2 Standard Genetic code : Q5: Given the following amino acid sequence: LLLLL QQQQQ When written out by its codon usage from species # 1 below, then will It be a palindrome? (1pt) Yes or No (circle one) If the antiparallel strand is correctly translated, then what will be that amino acid sequence? (1pt) ______________...
View Full Document

This note was uploaded on 02/15/2012 for the course BIO 710L taught by Professor Goldfarb during the Fall '10 term at Iowa State.

Page1 / 2

Quiz6 - MMMMM WWWWW When written out by its codons then...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online