Quiz10 - 1 2 3 4 5 6 7 8 9 10 11 12 Red only: Green only:...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Quiz#10 LC710 10/27/10 name___________ Given the following transgenes co-existing in the same animal. CMVp rtta I.R.E.S GFP tetO RFP Cellular Fluorescence observed prior to addition of Doxycycline is: Red Green Both Neither Q1 0.5 pt (circle one) : Q2 0.5 pt (circle one) : TATA rtta binds DNA if Dox is present Q3 : 1pt What does tta do in the absence of Dox?________________________ What does tta do in the presence of Dox?________________________ Cellular Fluorescence observed after addition of Doxycycline is: Red Green Both Neither
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Pax6p CreERt2 I.R.E.S GFP loxP-RFP-loxP-TOXIN ATAACTTCGTATAATGTATGCTATACGAAGTTAT = loxP sequence Hox1p Prior to addition of TAM, which Cells are:
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 1 2 3 4 5 6 7 8 9 10 11 12 Red only: Green only: Both: Neither: Above are WT cells in the brain expressing Pax6 and/or Hox1 Hox1 . After TAM addition, which Cells are: If expressed, TOXIN will Kill cells (disappear) Red only: Green only: Both: Neither: Given the following transgenes co-existing in the same animal. Q4 (2pts) Q5 (2pts) Q6 (2pts) : in the above transgene, loxP sites are in this orientation: This experiment is actually poorly designed and the loxP sites need to oriented as follows: Hox1p Why? TAM= TAMOXIFEN...
View Full Document

Page1 / 2

Quiz10 - 1 2 3 4 5 6 7 8 9 10 11 12 Red only: Green only:...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online