ps1, prob 11

ps1, prob 11 - codon in the cylon genome. How many possible...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Problem 11. “The cylons were created by man. They rebelled. They evolved. There are many copies. And they have a plan…” Cylon models affectionately known as “skinjobs” are part machine, part organic – they look and feel human. In order to increase our knowledge about cylons (and perhaps spot sleeper agents hiding among us), Dr. Gaius Baltar has given you DNA samples of known cylons. You run a series of experiments to learn about cylon gene expression. 1) You discover the cylons do not have a triplet genetic code. Four nucleotides make up a
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: codon in the cylon genome. How many possible cylon codons are there? 2) Stop codons have the same first three letters as in humans; the fourth is a wobble position (i.e. stop codons = UAAN, UAGN, UGAN). How many stop codons are in the following DNA sequence? 5 GTACGTGCCTTATTCGATCGATC 3 3 CATGCACGGAATAAGCTAGCTAG 5 3) The following mRNA sequence encodes the polypeptide His-His-Glu-Lys: CAUGCACGGAAUAAGC A mutation is induced that encodes the polypeptide His-His-STOP. What kind of mutation is responsible?...
View Full Document

Ask a homework question - tutors are online