exam3 key

exam3 key - AGRY 320 GENETICS EXAM3 5 April 2011 NAME

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: AGRY 320 GENETICS EXAM3 5 April 2011 NAME _______________________________________________________________________ This is a take-home exam worth 100 points. It is due at or before the beginning of class on Wednesday, April 13, 2011. Carefully read all of the information presented and follow the directions. Clearly provide the most likely answer to each question according to the instructions. Answers must be clearly presented to receive credit. BACKGROUND This exercise is an attempt to provide a simulation of forward genetics based on both real and fictitious data. You are a rice breeder in an area where bacterial leaf blight, caused by the bacterium Xanthomonas oryzae , is prevalent. You have identified a line of rice that provides some protection from the disease and you wish to discover the basis of that protection (leaf blight resistance). Using the sequence of the rice genome, you have used recombination analysis to narrow down the position of the resistance to a sequence on rice chromosome 2: Rice sequence-1. On line resources listed below will help you perform analyses that will enable you to answer the following questions. Sequence data files (blackboard) : Rice sequence-1 NCBI home page: http://www.ncbi.nlm.nih.gov/ Sequence analysis tools : BLAST, click on the Sequence Analysis tab on the NCBI home page and locate BLAST in the TOOLS section. Alignment tools: http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&PROG_DEF=blastn&BLAS T_PROG_DEF=megaBlast&SHOW_DEFAULTS=on&BLAST_SPEC=blast2seq&LINK_LOC= align2seq To a more limited extent, the Edit- Find tool in Microsoft Word can also be used as an alignment tool. Base counting tool : Word Count tool in Microsoft Word . Rice Genome Browser : http://rice.plantbiology.msu.edu/cgi-bin/gbrowse/rice/ FGENESH : http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind 2 1) ( 18 points ) The following sequences are associated with three DNA markers in rice (in sequence Rice sequence-1). The markers are named RICE1, RICE2, and RICE3. There are two alleles of each marker in the crosses that have been performed. a) Identify the position (base-number) of each marker in the sequence data provided (The Find tool works well for this). b) Determine the location of the allelic differences- align the two alleles. c) Design oligonucleotides that correspond 1) to the first 20 bp and 2) to the last 20 bp of each marker that can be used as primers in PCR to amplify the alleles of each marker. >Rice1 ALLELE A ggactatctgcatccgcatgcgagtaacacaatagcacatgcgggccaaaggatcgatcggttcttccctctgcaac aatctggaaggttcttgaaaaaccaactttttttaattttatgtggtcgggaatttatgatctcctttttttagtgc atgcaagcgaccactctgttattcgcccatgtagttcattgcttccttcacctaaccaatgttatattaactgtcag acagttttggtaaccttggctagagactcagcatggtgataatgcatgcagcaggctgatagctatgcg >Rice1 ALLELE a ggactatctgcatccgcatgcgagtaacacaatagcacatgcgggccaaaggatcgatcggttcttccctctgcaac aatctggaaggttcttgaaaaaccaactttttttaaaagatctttttgttttatccctaggggttgtattttctcca...
View Full Document

Page1 / 6

exam3 key - AGRY 320 GENETICS EXAM3 5 April 2011 NAME

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online