499B_lecture 1_08(1)

499B_lecture 1_08(1) - Biomedical Informatics C&IT 499B...

Info iconThis preview shows pages 1–12. Sign up to view the full content.

View Full Document Right Arrow Icon
Biomedical Informatics Michael D. Kane, Ph.D. FALL 2009
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
The Cell is a Living Machine
Background image of page 2
DNA is Information Storage
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
“Zipped Files” Decompression “Executable Files”
Background image of page 4
DNA is Double Stranded – One strand is the “coding strand” and the other strand is there to stabilize the DNA sequence when not in use. Double-stranded DNA is very durable in our environment.
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
CAGGACCATGGAACTCAGCGTCCTCCTCTTCCTTGCACTCCTCACAGGACTCTTGCTAC TCCTGGTTCAGCGCCACCCTAACACCCATGACCGCCTCCCACCAGGGCCCCGCCCTCT GCCCCTTTTGGGAAACCTTCTGCAGATGGATAGAAGAGGCCTACTCAAATCCTTTCTGA GGTTCCGAGAGAAATATGGGGACGTCTTCACGGTACACCTGGGACCGAGGCCCGTGGT CATGCTGTGTGGAGTAGAGGCCATACGGGAGGCCCTTGTGGACAAGGCTGAGGCCTTC TCTGGCCGGGGAAAAATCGCCATGGTCGACCCATTCTTCCGGGGATATGGTGTGATCTT TGCCAATGGAAACCGCTGGAAGGTGCTTCGGCGATTCTCTGTGACCACTATGAGGGACT TCGGGATGGGAAAGCGGAGTGTGGAGGAGCGGATTCAGGAGGAGGCTCAGTGTCTGA TAGAGGAGCTTCGGAAATCCAAGGGGGCCCTCATGGACCCCACCTTCCTCTTCCAGTCC ATTACCGCCAACATCATCTGCTCCATCGTCTTTGGAAAACGATTCCACTACCAAGATCA AGAGTTCCTGAAGATGCTGAACTTGTTCTACCAGACTTTTTCACTCATCAGCTCTGTATT CGGCCAGCTGTTTGAGCTCTTCTCTGGCTTCTTGAAATACTTTCCTGGGGCACACAGGC AAGTTTACAAAAACCTGCAGGAAATCAATGCTTACATTGGCCACAGTGTGGAGAAGCAC CGTGAAACCCTGGACCCCAGCGCCCCCAAGGACCTCATCGACACCTACCTGCTCCACA TGGAAAAAGAGAAATCCAACGCACACAGTGAATTCAGCCACCAGAACCTCAACCTCAA CACGCTCTCGCTCTTCTTTGCTGGCACTGAGACCACCAGCACCACTCTCCGCTACGGCT TCCTGCTCATGCTCAAATACCCTCATGTTGCAGAGAGAGTCTACAGGGAGATTGAACAG GTGATTGGCCCACATCGCCCTCCAGAGCTTCATGACCGAGCCAAAATGCCATACACAG AGGCAGTCATCTATGAGATTCAGAGATTTTCCGACCTTCTCCCCATGGGTGTGCCCCAC ATTGTCACCCAACACACCAGCTTCCGAGGGTACATCATCCCCAAGGACACAGAAGTATT TCTCATCCTGAGCACTGCTCTCCATGACCCACACTA
Background image of page 6
THEREDCAT_HSDKLSD_WASNOTHOTBUT_WKKNASDN KSAOJ.ASDNALKS_WASWET_ASDFLKSDOFIJEIJKNAW DFN_ANDMAD_WERN.JSNDFJN_YETSAD_MNSFDGPOIJ D_BUTTHEFOX_SDKMFIDSJIR.JER_GOTWET_JSN.DFOI AMNJNER_ANDATEHIM.
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Start with a thin 2 x 4 lego block… Add a 2 x 2 lego block… Add a 2 x 3 lego block… Add a 2 x 4 lego block…
Background image of page 8
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
What are the comparative genome sizes of humans and other organisms being studied? organism estimated size estimated gene number average gene density chromo -some number Homo sapiens (human) 2900 million bases ~30,000 1 gene per 100,000 bases 46 Rattus norvegicus (rat) 2750 million bases ~30,000 1 gene per 100,000 bases 42 Mus musculus (mouse) 2500 million bases ~30,000 1 gene per 100,000 bases 40 Drosophila melanogaster (fruit fly) 180 million bases 13,600 1 gene per 9,000 bases 8 Arabidopsis thaliana (plant) 125 million bases 25,500 1 gene per 4000 bases 5 Caenorhabditis elegans (roundworm) 97 million bases 19,100 1 gene per 5000 bases 6 Saccharomyces cerevisiae (yeast) 12 million bases 6300 1 gene per 2000 bases 16 Escherichia coli (bacteria) 4.7 million bases 3200 1 gene per 1400 bases 1 H. influenzae (bacteria) 1.8 million bases 1700 1 gene per 1000 bases 1 Genome size does not correlate with evolutionary status, nor is the number of genes proportionate with genome size.
Background image of page 10
Molecular Biology TERMS: DNA = deoxyribose nucleic acid, a polymer 4 nucleotides or “bases” arranged in an anti-parallel,
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 12
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 27

499B_lecture 1_08(1) - Biomedical Informatics C&IT 499B...

This preview shows document pages 1 - 12. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online