exercise_1_spring_11 - of the organism that the gene/mRNA...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Biomedical Informatics (CNIT458) SPRING 2011 Exercise 1 (KANE) For full credit, use the unknown genetic sequence (gene) assigned (each of you has 1 genetic sequence – see XLS file on course web page), and search this gene using GenBank/BLAST to complete these tasks. THIS IS DUE BY 5:00, MONDAY, JAN-24. Email your completed tasks to mdkane@purdue.edu ; providing… BLASTn your sequence against the “Non-redundant” (nr/nt) database to derive: 1) the Title of the gene/mRNA (from GenBank record). 2) The “common” name
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: of the organism that the gene/mRNA is derived. 3) The common name of the organism that is most similar to #2, based on sequence similarity. 4) The FASTA format of the full sequence EXAMPLE (for lecture demonstration) AATGGTTGAACGGTTCTTGTATGAGCTGTGAATTCTGTCAACAAGGTGCTGAACCAAACTGTGGTGAAGC TGACTTGTCTGGTTACACTCACGATGGTTCATTCGAACAATACGCTACTGCTGATGCTGTCCAAGCCGCT AAAATTCCAGCTGGTACTGATTTAGCCAATGTCGCACCAATCTTATGTGCTGGTGTTACTGTTTACAAAG CCTTAAAGACTGCTGACTTAGCAGCTGGCCAATGGGTTGCTATCTCCGGTGCTGGTGGTGGTTTAGGTTC...
View Full Document

This note was uploaded on 02/29/2012 for the course CNIT 458 taught by Professor Michaelkane during the Spring '11 term at Purdue University-West Lafayette.

Ask a homework question - tutors are online