lecture SPRING 08 7microarray clustering

lecture SPRING 08 7microarray clustering - From: Duggan...

Info iconThis preview shows pages 1–15. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: From: Duggan et.al. Nature Genetics 21:10-14, 1999 Microarray-Based Assays ( Microarray-Based Assays ( The Basics The Basics ) ) Each feature or spot represents a specific expressed gene (mRNA). The fluorescent intensity of each feature correlates with the expression level of the gene (mRNA) in the samples under investigation. 384-well plate Microarray Production Microarray Imaging Microarray Hybridization Microarray Raw Data Analysis Microarray Statistical Data Analysis Biological Samples Three Distinct Bioinformatics Approaches in DNA Microarray Utilization 1) DNA Probe Design 2) Raw Data Analysis Image Analysis 3) Genomic Clustering The Key to Nucleic Acid Detection is Sequence-Specific Affinity C A G T A A C G G T T 5 3 G T C A T T G C C A A 5 3 GC content (base paring) generally dictates thermodynamics of complementary binding. Tm = Melting Temperature Microarray-Based Assays ( Microarray-Based Assays ( The Basics The Basics ) ) PROBE is DNA spotted (attached) to the solid substrate (non-fluorescent glass slide). TARGET is the fluorescence labeled cDNA representation of the mRNA and is hybridized to the probe. Microarray-Based Assays ( Microarray-Based Assays ( The Basics The Basics ) ) Raw Data Analysis Image Analysis ... GCUACGAUUGCAACGCCCGAAUGGUUACC AAAAAAAAAAA ... dCTP dATP dTTP dGTP How does a DNA microarray detects gene activity? Reverse Transcription makes cDNA from gene sequence AAAAAAAAAAAAAAAA mRNA TTTTTTTTTTT G G T A A C C C C C C C A T T G G G G T T G A A T G T A G cDNA TTTTTTTTTTT G G T A A C C C C C C C A T T G G G G T T G A A T G T A G 2-Color System... RNA from Normal Tissue RNA from Cancer Tissue dCTP dCTP Reverse Transcription 2-Color System... Detection Raw Data Analysis Image Analysis 2-Color Laser Scanner Microarray Oligonucleotide Probe Design System Microarray Oligonucleotide Probe Design System Experimental Assessment of DNA Binding Behavior Experimental Assessment of DNA Binding Behavior Design and Implementation Design and Implementation 1) AGCCCGATGATGAGCGACTCACCACGGGCCACGGCTTCTGACTCTCTTT 2) AGCCCGATGATGAGCGACTCACCA G GGGCCACGGCTTCTGACTCTCTTT 1 3) AGCCCGATGATGAGC C ACTCACCACGGGCCA G GGCTTCTGACTCTCTTT 2 4) AGCCCGATGAT C AGCGACTCACC T CGGGCCACGGC A TCTGACTCTCTTT 3 5) AGCCC C ATGAT C AGCGA G TCACC T CGGGCCACG C CTTCTGACTCTCTTT 5 0.00 0.10 0.20 0.30 0.40 0.50 0.60 0.70 0.80 0.90 1.00 1 2 3 4 5 Normalized Target/Probe Microarray Oligonucleotide Probes 32 C 42 C 52 C Assessment of Sequence-Specific Cross-Reactivity/Cross-Hybridization Microarray Oligonucleotide Probes Mismatched Base Pairs Kane, MD et. al. Gene Cloning and Expression Technologies (2002) Ch. 35:537-547 yicK cDNA yabM cDNA yeiO cDNA Yick_337 Yick_884 Yick_GAP Yeio_997 Yeio_469 Yeio_GAP Yabm_392 Yabm_552 Yabm_GAP % Homology Oligo Name Sequence yick yeio yabm yick_337 gcgtacttctgagtagttttgcttccaccgcaaacccgcaaatgttcgcc 80% 56% yick_884 aatgtgtttttacgccagcgtactcatggcgacgactccggcggttgagc...
View Full Document

Page1 / 51

lecture SPRING 08 7microarray clustering - From: Duggan...

This preview shows document pages 1 - 15. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online