BIMM 120 Lecture16.Metagenomics.052411

BIMM 120 Lecture16.Metagenomics.052411 - BIMM 120...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: BIMM 120 Announcements • HW#2 is available on WebCT – due Tuesday May 31 Please note there are two (2) files: ASSIGNMENT & DATA FILE • Paper #3 is also available on WebCT – we’ll cover this on Thursday... Hehemann J-H et al. (2010) Transfer of carbohydrate-active enzymes from marine bacteria to Japanese gut microbiota. Nature 464:908-912. A modest request from your humble professor... PLEASE complete a CAPE evaluation for this class! ...as usual... ...as Lecture 15 – Microbial Bioremediation ☑ Mercury □ Heavy Metals & Radionuclides Heavy □ Xenobiotics (herbicides and pesticides) Xenobiotics (herbicides □ Oil contamination Oil Microbial Mercury Resistance Microbial mer (mercury resistance) operon periplasmic binding protein Organomercury lyase transcriptional regulator merR merP merT transport protein Hg2+ oxic/anoxic transition merB merA Mercuric (Hg2+) reductase Hg-X Hg0 (volatile) regulatory protein sulfate reducing bacteria (X = organic complexes, reduced S compounds) merA merD CH3-Hg+ merB Hg2+ to the atmosphere Microbial activities both promote and derail Methyl-Hg production! Environmental Remediation Environmental Why? • Legislation to deter/limit release into the environment How? • Application of bioremediative strategies to clean up the mess! • Immobilize, sequester, or otherwise transform pollutant to allow removal from the environment DOE Environmental Science Remediation Program Bioremediation strategies must consider mobility of contaminants (e.g. hydrology of the system & fate of the remediated pollutants) as well as secondary biotic & abiotic consequences (e.g. anoxic/oxic transition & re-oxidation/reduction by other microbes) Heavy Metal & Radionuclide Toxic Wastes Heavy Uranium (U) Chromium (Cr) Mercury (Hg) Technetium (Tc) Lead (Pb) Arsenic (As) Fate of microbially reduced toxic metals and radionuclides Microbes can reduce toxic compounds leading to their immobilization thus preventing further transport through the environment (reduced states tend to be less soluble) As you know, these are dissimilatory metal reducing bacteria that use metals as terminal electron acceptors Uranium Immobilization Uranium mobile phase cytochromes membrane-bound heme proteins involved in electron transport oxide, mineral phase slows it roll.... dissimilatory metal reducing bacteria The microbes dump electron on extracellular compounds to remain redox balance Recall, “dissimilatory” as opposed to “assimilatory” means they don’t actually take the Uranium up into their cells... Biostimulation of subsurface (or aquatic) microbes capable of this metabolism is being used to clean up radionuclide contaminated sites Biostimultion of Microbial Metabolisms in situ of in Rifle, CO Uranium contaminated sediments and aquifer • Acetate (CH3COO-) is a tasty C source for many bugs but a preferred C source for certain anaerobic species like Geobacter sp. • In the subsurface where O2 is low, alternative electron acceptors such as Fe3+ and U6+ are used in the oxidation of the electron donor acetate • This results in the reduction of toxic metals (e.g. U6+ U4+) rendering them less mobile and concentrates the contaminants in a discrete zone for subsequent removal Subsurface injection gallery Industrial / Agricultural contaminants Industrial “xenobiotics” pesticide insecticide herbicide herbicide dielectric fluid in electronics herbicide general solvent; anesthetic; decaffinator; degreaser Although none of these compounds exist naturally, microbes can break them down a Structure shown on previous slide Oxidative Dechlorination of PCBs Oxidative of polychlorinated biphenyls as electron donors a chlorinated biphenyl Reaction sequence in Pseudomonas sp. These are just other tasty organic compounds for microbes source of carbon, electrons, and energy.... hydrolysis catalyzed by complex OXIDASE enzymes Reductive dechlorination of highly halogenated PCBs complements this process (use of PCBs as electron acceptors!) Deepwater Horizon oil spill Deepwater oil Gulf of Mexico – April 2010 > 185 million gallons released from April to July 2010 Crude oil chemical complexity Crude Effects of biodegradation on oil composition Effects Light crude oil this is most similar to the oil released in the Gulf of Mexico Saturated hydrocarbons are the first to go... followed by non-cyclic terpenoids Heavy oil (slightly degraded) Cyclic terpenoids are some of the last to go... The biodegradative potential of a spill will depend on the oil’s initial composition Microbial Degradation of Hydrocarbons Microbial • Successional changes in community composition allow for iterative steps of the biodegradation process 1º 2º 3º ... • Hence, a community “co-metabolic” effort! (oil CO2) Profiles of cell density, fluorescence, and dissolved oxygen within and outside the Deepwater Horizon oil plume at depth Location close to spill source Location outside oil plume Location close to spill source Location outside oil plume Cell counts Fluorescence indicates the presences of oil O2 anomalies indicate microbial respiration Cell counts • Cell number increased where there is oil • Where there are more cells, there is less O2 indicating the microbes are actively respiring • Native microbial communities responded quickly to the input of oil • The species that were enriched were different than in non-impacted locations • The metabolism of these oil-degrading bacteria was enriched with hydrocarbon degradative capabilities Hazen et al. (2010) Science 330:204. BIMM 120 BIMM Lecture 16 Metagenomics: Sampling the Unknown Tuesday May 24, 2011 Extent of microbial diversity Extent ~ 5 x 1030 microbial cells globally representing > 107 species !! The Great Plate Count Anamoly all species 1L seawater ~ 109 cells (n) X 102 different species lab-based cultivation may only recover between 1 – 10% of species ! What about the remaining species we can’t analyze in the lab? How do we learn who they are, what they are doing, and how they are doing it ?? “Cultivation-independent” analyses are a MUST analyses Quantifying microbial abundance in natural samples • Non-specific fluorescent nucleic acid stains - DAPI - Acridine Orange - SYBER Green • Viability stains labels all cells green = SYTO9 red = propidium iodide labels only dead cells (both are nucleic acid stains) Live cells are GREEN / Dead cells are RED These techniques tell us there are a lot of microorganisms out there, These but they do not tell us anything about who they are or what they are doing.... are The rise of cultivation-independent The molecular microbiology & microbial ecology (& Jill Banfield) These modern techniques allow us to peer into the secret lives of microbes that cannot (yet!) be grown in the laboratory Metagenomics can tell us who is out there, what they are doing, can and how they are doing it! METAGENOMICS cultivation-independent DNA sequencing of environmental samples environmental genomics ecological genomics population genomics community genomics Insight into the global Insight metabolism of entire communities GENOMES IN THE CONTEXT OF THE ENVIRONMENT OUTSTANDING QUESTIONS IN OUTSTANDING MICROBIAL ECOLOGY AND EVOLUTION metagenomic opportunities metagenomic opportunities Physiology & metabolism Physiology genetic & metabolic potential of uncultivated organisms genotype : phenotype linkage activity in the environment Autecological phenomena phenomena genes of unknown function environmental adaptation cultivating the uncultivated biogeographical patterning patterning diversity & spatio-temporal dynamics Evolutionary processes environmental control of expression modes and tempo of species evolution / selection modes species definition Discovery Discovery novel genes, metabolisms, physiologies novel diversity Isolates Community ≠ Communities are organized consortia of microbial Communities species and strains whose aggregate properties exceed the sum of their constituent members Metagenomic analysis can provide a window into analysis interspecific interactions and community processes interactions Microbial Microbial Habitats Habitats (just a few examples...) Agar plate with isolated colonies Cultivation in liquid media Make genomic sequencing library Sequence Sequence Sequence Schematic of isolate-based genomics Scaled-up cultivation Harvest cells & Extract DNA Assemble & Analyze Genome of my green isolate example: example: Mycoplasma pneumoniae, complete genome complete genome Mycoplasma 816,394 bp 733 genes (circular map) (linear representation) Seawater Environment Make genomic sequencing library Sequence Sequence Sequence Schematic of metagenomics Harvest cells & Extract DNA Assemble & Analyze Genomes from my environment ...the metagenomic approach... ...the approach... in situ • field collection • geochemistry • sample preservation ex vivo ex • DNA extraction • library construction • DNA sequencing in silico in • read processing • QA/QC • sequence assembly • binning • annotation • comparative genomics • metabolism/physiology in situ in field-based sampling & data collection Genome sequence information Know the organisms Know the environment Know the ECOSYSTEM Diversity of organisms Geochemistry, Physical processes Ecology of the system Recovering microbes from environmental samples filtration-based fractionation Raw Seawater 20 µm screen 3 µm filter 1.6 µm filter 0.1 µm filter 30 kDa TFF 3 – 1.6 µm < 0.1 µm 1.6 – 0.1 µm 20 – 3 µm > 20 µm Recovering microbes from environmental samples filtration-based fractionation Raw Seawater DNA extraction 0.1 µm filter 16S rRNA Genomic libraries FISH Physico-chemical characterizations Physico • Location, Time, Date • Temperature, Salinity, Pressure • Geochemical analysis: Nutrients, Trace Elements, O2 • Mineralogy • Pigments: chlorophylls, carotenoids • Hydrology, Transport vectors & Physical processes Critical to correlate microbial genotypes/metabolisms with prevailing environmental conditions Spatial / Temporal sampling Why are certain organisms present in one location and not another? Why are certain organisms present at one time but not another? ex vivo laboratory-based sample processing & DNA sequencing Processing of recovered cells 0.1 µm filter cut filter in situ hybridization Archival (-80ºC) / culturing Genomic DNA extraction Bact/Arch Genomic DNA library Cloning or direct sequencing 16S rRNA gene PCR library “Universal” conserved primers estimation of sequencing demand (target species richness and evenness) environmental sample target community 16S rRNA gene library species 1 abundance species 2 species rank species 3 species 4 Quantitative 16S rRNA fluorescence in situ hybridization (FISH) Bacteria Archaea count cells via epifluorescence microscopy Estimation of sequencing demand (species richness and evenness of the sample) Bacterial 16S rRNA library Archaeal 16S rRNA library Bac 1 Arc 3 Bac 2 Arc 1 Arc 4 Arc 2 Bac 3 FISH Bac 4 56% B1 24% B2 12% B3 8% B4 Bact/Arch 85% A1 8% A2 5% A3 2% A4 80 % Arch 20 % Bact TOTAL COMMUNITY RICHNESS & EVENNESS 68.0 % Arc1 11.2 % Bac1 6.4 % Arc2 4.8% Bac2 11.2 6.4 4.8% 4.0% Arc3 2.4% Bac3 1.6% Arc4 1.6% Bac4 2.4% 1.6% Genome coverage is proportional to abundance in the library Genome 8 dominant species 1.6% 68% genomic library * Mostly gray DNA GE N O M E abundant types >> CO VER AG E moderately abundant types > moderately rare types 8X coverage of Arc1 ~ 35.3 Mbp 8X coverage of Bac4 ~ 1500 Mbp *Assume avg. genome size ~ 3 Mbp Genomic library construction Genomic Mixed community DNA Shear Library DNA extraction DNA SEQUENCING Paired-end DNA sequencing Paired forward reverse metagenomic library clone F primer ~ 800 bp aaatccattgacggaattcagattccaattggacATGAGCAGTTACATACA……….TACTCGTCAATGTAGTattaggtaactgccttaagtctaaggttaacctg ~ 800 bp R primer Only the extreme ends of the insert DNA are sequenced Small insert (2-4 kb) Intermediate insert (8 -10 kb) Large insert (>40 kb) the gray region is the environmental DNA insert • Allows high-throughput processing of clones • Only requires two sequencing primers complimentary to known vector sequence • Archiving of clones (e.g. in the freezer) allows for the design of new primers for “walking” further into the sequence in silico in computational analysis of raw DNA sequence data Contemporary analysis scheme for Contemporary analyzing metagenomic data sets data Sequence generation Isolate genome = single source of DNA Puzzle A Puzzle A sequencing reads Environmental genome = multiple sources of DNA Puzzle A Puzzle C Puzzle A Puzzle B Puzzle C Puzzle B Puzzle D Puzzle D metagenomic reads “Read-based” versus “Assembly-driven” Analysis versus Analysis First rule of Metagenomics The level of environmental sequencing must be commensurate with the diversity of the sample • Undersampling greatly complicates interpretation due to incomplete data sets! • Most metagenomic projects do not have the requisite coverage of individual populations to allow assembly Fishing for genes Fishing Sea of fish sampling library library Sea of genes sequencing sequencing annotation of sequencing reads annotation Random sampling of environmental sequences provides an inventory of protein functions “Read-based” Analysis Analysis species A B C D E F phylogenetic 7% 7% binning G 5% H 3% 11% raw metagenomic reads 15% 21% 30% Percent abundance in the sample (species A is MOST abundant) Gene prediction Functional annotation Such analyses can provide a thorough inventory of functional capabilities within a community! For example, samples from the ocean surface will contain photosynthesis genes On the other hand, samples collected at 5000 m depth will NOT! I 1% “Assembly-driven” Analysis Analysis This genome can be analyzed like any other genome: • comparison against other sequenced genomes • comparison against other populations in the same community 3.5 Mbp genome of environmental Haloquadratum population Phylogenetic Binning Phylogenetic assigning DNA fragments to organismal “bins” contigs or raw reads ? species A species B species C species D species E species F Metrics = nucleotide composition / homology to sequenced genomes / depth of coverage depth Annotation of genome fragments Annotation assignment of functional data to predicted genes species A species B species C species D species E species F species E contigs Hey, this species can fix nitrogen! ATPase DNA polymerase I Hypothetical protein NifH NifD NifK N bp 1 transposase His Kinase Response regulator gene (ORF) prediction functional assignments Each gene is linked to a lineage...just like an isolate genome AT AT CG GC AGA G AG ATATACATG GA GC AG AG G GTGCG CT AG C CTC TA T GATA GCA TGCAGATCG C CAT T TAG GAT AG G AC C ACCGA TAT A C TATAGCTAGATGG ATAGCC G AGGC A A AG A G T G A C AG TATG C GAT ACC T TT A GA A GTGCGG C C C GAAACC GCGCA A GC CACCTA G G C TCCTAAG T GCGGA T TAGGCCATAACAGG GAGGGATC AT GG T T A A G AA G C A A T TAG CA GT A GAG GCGG G G A T ACCGGG TG ATATT C G TAAT TGC AGAGGAT ATC A CT GGTGCCC GATTA A T C C C ACG GA TATTACA GAGATA G TG A GA C TA GCTG G ACTA C AGAG CGATTAATACGGCAATCGGAAT GAGTGGTAGGCAGG TTAGAGGCGGCTC CG TA G T C G C C A ATGGAGGCGA ATAGA C G A G CG AA C A ATAGCTAGCAGG GG GAT GAGTGCGAGC GGAAGAGCT T A TA A GA GAAAG GA TA TC A G GCT ATCAACG G GCAG A T CCG GATAGG AATAGGA GAGTGCAGC C ATAGTAATA TA G CGGT ATTAGCTAGTTGC GAGAGCGAC ATGTGCG A G GC C GAGAAG GA ATA ACTCGCCTG GA T C G G ATTGAT TGAGATGCCGA G GG TAAGTAAAGCGAACC CAGTAGACGC TAAT TG A GACAGAGCAGGAAGGAGTACTGT AG A CAT TAGGATAAAAGC AG CGT C T TAG T T AAT GG T C CGG AG GC AT TT A T TGAAG AA C GA TTTG GGTAAGAGGCGGTCCC ATTAG AG A AGCC A T G T TAGCGA T ACTAGATAGATGAC TA GGT GC TA GCTAGGCAGGTAGATGCGGGATATTAG CTAGC C A CAT A AG CACTCTG AGC GA G A A G T AT AGGATATAGCAGCGACG A CTG G T G GA AGA TGA G GAA CAA G TTA GCAGTGGCACCCCCG G CGC CG AGAGTTAAGA TG G GT A TCCTAACAT T GCAGAGCAGAGCGAATGC TAGG GC GG G GC AA T CCTAA G GGTA TGC GCTAG GAAGAACG TGAG TAG CG ACACGA A C CT G AA T CGAG G G G CA C TA AA GCG CGTG T AGATGGCATAT CGAGCAGATG TC AGAAT CT G G GG G CATGCAG ATG GC AA T AGT AGG G AT TA T T T CT G C AG C G CA T CGA AT C GCG G GAGC AT GGTC AG G TG AA TA C G GC GC A CT AT G C GCTATGCG GA ATAGCTAG TA CA G CT GAGTGCGATATAGC AG GAGTGCGATATAG G C AG C TG A CG AT AT AG C G AG C AG C GG GA G AT AA GT TGATATAG AG AG A GCGCG CG AG C AT GA GG A GT A C GAT AGATCTA AG TG AT A G AG TT AGG GC GT G CACC G AG TG TAAG ATA ATCTGAGCGCGGCGC A G C A AATGAG T GT CG G CGTA CGAATGACGGCAGGT TAGCAATCAATAGC CG C C A ATCC A C G A AG T AG TGCA A AGCC AGGTA G GG T A AGC CGA GTG CATCCAGAATGCTGC CCGAA T TGCG G AT T G AG G TG AG A GC TG AA GGAATAATGTGA TCA CGA GTAT G ATC GA CGGGAGCT GCGTA TAGAGGCTAGCATAGGGATAGCTCGA G C A CC GG A ATG G AT TCT A AA AG T A C ACGG GGCTTAAG C GCG CGTAGC AGC AT C A TGG AAG T A G AG A T AGTAGCGAT C T ATGA GAT GGCTGGTAAGTGTGGG CAGTGAGCCGA AT GCAT A CA G CGA G G ATAAGGACG C C CC TC GA T AGGAGCTAGATGG ATCTTACTATCGCGATA ATA TG AGAAAG G T GG A G CAGGTTCAACCGGTAGC A CT GA A TTAG TAGGG CC ACAG CGC TGATAATAATGGAGCAGCTG AT TTTAGC G GG GTAAA T GCG G GAATTAGCAGATAGCTGGA TAG A AG TAGC C C GG G AA GCGCACAATGAGCACA AAT C A A GACA T A G T GATT CTA G T GTATGGTGA GCGCCG ATGG CT G A T T ATGA TA G G GG GA TAGATACCTGCGGGAGAACAG AG GA C C T G AGTC AAAAAGAACG GGTAACGCTGCTAG TGCG CT T AAG G GCG A T AA A A G C G GCTAGGCA CGCTGGAACCCTAAGCA C AGA AG GA GGC CG TG C ATAG CAGAGCAGATG C CC T TG C TTATG GG GATGAAGAG GAAAG T GC AT A ACT CG CG CCTG A GCA G GCAG GC AT GGTG G GCTAGCCATG A A GCAGA G T C AC GAAGGTAT T TG TTT A T AT G A TG G G TAAT GCC AG G AT CG TACG GG A AA TA G AG AGG GC G AC G CT GC T A GC C CA A TA G C G AT A G G GC TA TG CG GC AT TA AG G TA T AG CGA CGA C TG TAGCAG GGC TTTAGC TAG A GA ATGC C G G CT A TA GCTG TT AA GAT Assembly, ‘Binning’, Annotation, Comparative genomics AGATGCATGCGAATGCGATAGCTAGATGCCGGTGCGAAATAGCTA AGATGCATGCGAATGCGATAGCTAGATGCCGGTGCGAAATAGCTA AGATGCATGCGAATGCGATAGCTAGATGCCGGTGCGAAATAGCTA extreme environments Why extremophiles? Why • Ocean Water = ~ 1 million cells per ml (12 ounces = 353 ml) your average soda can of sea water contains >350 million bacteria ~ 400 different species • Soil = ~ 10 million cells per gram ~ 3,000 different species • Human gut = 1 quadrillion (1015) cells [a million billion] ~ 10,000 different species Such environments are very diverse... They represent moderate (“gentle”) habitats where many types of microbes can thrive In contrast... In Extreme environments have very low diversity because their extremity precludes average microbes from surviving How long would your average organism last in boiling water or submerged in battery acid? ~~~ Most extreme environment have very few species !! To survive in such environments, extremophilic microorganisms require a multitude of biochemical and physiological adaptations Extremophiles Extremophiles pH salinity pH 0 pH 12 32 % salt Acidophiles Alkaliphiles Halophiles temperature pressure 113ºC -10ºC 1000 atm Thermophiles Psychrophiles Piezophiles Community Genomics the analysis of species populations and their interactions, recognizing that both species composition and interactions change over time and in response to environmental stimuli Community Genome species B species A species E species D species C Genome sequence information reveals the genetic and metabolic potential of an organism AGATGCATGCGAATGCGATAGCTAGATGCCGGTGCGAAATAGCTA AGATGCATGCGAATGCGATAGCTAGATGCCGGTGCGAAATAGCTA AGATGCATGCGAATGCGATAGCTAGATGCCGGTGCGAAATAGCTA Reconstruct metabolism/physiology of each organism based on genome sequence Community Genomics the analysis of species populations and their interactions, recognizing that both species composition and interactions change over time and in response to environmental stimuli Community Genome species B species A species E species D species C Genome sequence information reveals the genetic and metabolic potential of an organism AGATGCATGCGAATGCGATAGCTAGATGCCGGTGCGAAATAGCTA AGATGCATGCGAATGCGATAGCTAGATGCCGGTGCGAAATAGCTA AGATGCATGCGAATGCGATAGCTAGATGCCGGTGCGAAATAGCTA Resource for mapping microbial community metabolism onto environmental processes Acid Acid Mine Drainage Iron Mountain, CA biofilm Fe2+ Fe3+ (pH 0) partitioning of community essential roles C and N fixation EPS production (cellulose synthase – biofilm formation motility (response to ferrous iron and oxygen gradients) efflux pumps and enzymatic activities (high ionic strength and pH tolerance) copper, arsenite, mercury, zinc, silver, and cadmium resistance genes electron transport chain components and novel cytochromes – Fe oxidation ! Next up: Lecture 17 Lecture Symbioses ...
View Full Document

Ask a homework question - tutors are online