Bio200Exam3W12KEYhrb - Biology 200 Exam 3 Winter Quarter,...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Biology 200 Exam 3 KEY Student Name____________________________________________________ Winter Quarter, 2012• Hannele Ruohola-Baker 1 TA Name _________________________________________ INSTRUCTIONS: THERE IS ONLY ONE CORRECT ANSWER FOR EACH QUESTION. Go to the rightmost column of your answer sheet (side 2, begin with #101). Mark only one correct answer per question. Only your answer sheet will be graded. 101. (3 pts.) Which of the following cannot be accomplished by PCR? A) chromatin remodeling. (1p) B) paternity testing. C) forensic testing. D) maternity testing. E) cut of double-stranded DNA (1p) F) A, B, C G) A, E (3p) 102. (2 pts.) Your PCR annealing temperature was too low. What is the most likely outcome in your gel electrophoresis analysis? A) You will detect many extra bands (2p) B) You will detect the expected number of bands but they are located too high in the gel C) You will not detect any bands in the gel.(1p) D) You will only detect half as many bands are expected. 103. (2 pts) Katie is concerned that she put her students’ DNA samples from the first PCR lab into the thermocycler and ran the wrong program. Instead of heating the samples to 95 C, she ran a program that heated the samples to 75 C. If she did in fact make this mistake, which step in the PCR process would be most negatively affected based on temperature and why? A) Annealing; 75 C is too low for this to occur B) Melting; 75 C is too low for this to occur (2p) C) Elongation; 75 C is to high for this to occur D) Melting; 75 C is too high for this to occur E) Elongation; 75 C is to low for this to occur
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Biology 200 Exam3 Student Name____________________________________________________ Winter Quarter, 2011• Hannele Ruohola-Baker 2 104. (2 pts.) Matt is studying the plant Arabidopsis thaliana in his Bio499 project in the lab. One of the alleles of the genes he is studying has an insertion (like the ALU insertion from lab), which is too long to amplify by traditional PCR. How many PCR primers (at minimum) would Matt need to introduce to be able to identify a plant, which is heterozygous for that element? A) 1 B) 2 C) 3 (2p) D) 4 E) 5 105. (4 pts.) 5’ TAGCCGCATGGGCTCGTACG(400nt)TAAACGATAGTTTAGCGCTA 3’ 3’ ATCGGCGTACCCGAGCATGC(400nt)ATTTGCTATCAAATCGCGAT 5’ The sequence above contains an ALU insertion that is 400 nt long. You wish to determine whether you have the ALU insertion at this particular locus. Which of the following primers would be the most appropriate? A) 3’ TAGCCAAA 5’, 3’ ATCGCGAT 5’ B) 5’ GCCGCATGG 3’ , 5’ GCGCTAAAC 3’ (4p) C) 5’ AAACCGAT 3’ , 5’ TAGCGCTA 3’ D) 3’ ACTTGCCG 5’, 3’ TAGCGATC 5’ E) none of the above, only the primers that detect the Alu sequence would be appropriate 106. (2pts.)
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 03/08/2012 for the course BIOL 200 taught by Professor Jimlara/stevehauska/hannalerhoula-baker during the Spring '09 term at University of Washington.

Page1 / 11

Bio200Exam3W12KEYhrb - Biology 200 Exam 3 Winter Quarter,...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online