08BIS1012012ReplPCRTeloLect7

08BIS1012012ReplPCRTeloLect7 - BIS101-001: Genes and Gene...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: BIS101-001: Genes and Gene Expression Replicating DNA: Telomeres and Applications (PCR) Lecture #8 Chapter 7 and 10 March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 1 Telomeres and Replication of Linear Chromosomes Replication of linear DNA molecules or chromosomes, creates a problem of enormous biological significance. This problem is resolved with repetitive DNA sequences called "telomeres" and with a special enzyme called "telomerase". March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 2 Replication of Linear DNA Molecules "eye" structure 3' 5' 5' 3' 3' 5' 3' 5' 5' 3' "Y" structure 5' 3' 3' 5' March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 3 Lack of last primer causes gaps at one end When one replication fork reaches the one end of a linear DNA molecule, parental strands separate preventing the priming of the last Okazaki fragment. Origin 3' 5' March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 4 Replication of Linear DNA Molecules (p. 476) Sequential replication of linear DNA molecules or chromosomes will result in shorter and shorter chromosomes. 3' 5' + 3' 5' Shorter chromosome with a protruding 3'OH 5' + 3' 5' March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 5' 3' 5' 3' 3' 5' 3' 5' 3' 5 Telomeres and Protruding 3'OH Groups Protruding 3'OH on the ends of chromosomes create two types of problems. q Without some maintenance and extension, they will result in shorter chromosomes by degradation or sequential replication. Nature uses repetitive DNA sequences on the ends of chromosomes called "telomeres" to solve this problem. In humans, the sequence, 5'-TTAGGG-3' is repeated several hundred times on the ends of chromosome. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 6 Telomere Repeat Sequences Species Arabidopsis Human Oxytricha Slime Mold Tetrahymena Trypanosome Yeast Repeat Sequence TTTAGGG TTAGGG TTTTGGGG TAGGG TTGGGG TAGGG T,G1-3 (TGTGGTGGGTGGTG) TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG3' AATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCC5' March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 7 Telomerase is a RNA containing enzymes Telomerase polymerizes new DNA from the 3'OH of the telomere. Telomerase binds to the telomere though H-bonding between the repetitive sequence and a small RNA in the telomerase. 5' 5' http://www.youtube.com/watch?v=AJNoTmWsE0s March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 8 Telomeres and Aging and Cancer Telomeres play an important role in the aging process. Most human cell types are mortal in cell culture. They divide about 50 times before they die. During these 50 generations, the ends of chromosomes shorten. While there is telomerase activity in embryonic cells, there is little or no activity in normal somatic cells. Telomere shortening may represent a built-in clock that counts cell divisions and determines the aging process. Cancer cells in culture are immortal and continue to divide indefinitely. In cancer cells, chromosomes do not shorten and telomerase activity can be found. Forcing normal human cells to express telomerase increases the number of cell divisions. BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 9 March 19, 2012 Telomeres and Aging and Cancer Does telomerase represent the molecular of youth." Could humans be engineered to express more cellular telomerase. What is the role of emotional stress and caloric restriction on telemere length and longevity? What are the scientific, medical, ethical and social implications of telomerase engineering? "fountain March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 10 Applying the Principles of DNA Replication Polymerase Chain Reaction (PCR) March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 11 PCR Vocabulary Amplicon: The DNA generated by the PCR amplification of the target DNA sequence. Cycle Threshold (Ct): The cycle that a theoretical threshold runs through the exponential phase of an amplification curve. Dynamic Range: The ratio between the weakest and strongest signal of a changeable quantity (e.g., light or sound) that can be detected. A good quality LCD display has a dynamic range of around 1000:1. Exponential Phase: That phase of the PCR in there is a log/linear relationship between cycles and amplicon concentration. FRET: Fluorescent Resonant Energy Transfer. A method for detecting PCR product in the exponential phase of the reaction. Real Time PCR: A form of PCR in which the amplicon is measured during the exponential phase of the reaction, not a the end point. Reverse Transcriptase: RNA-dependent, DNA polymerase used to convert mRNA to complementary or cDNA. Rn: A measure of amplicon based on the fold change in reporter signal divided by ROX fluorescence. ROX: A red passive reference fluorescent dye used in RT-PCR to calculate fold change in amplicon. SYBR Green: A green fluorescing intercalating dye that quantitatively binds to dsDNA but not to singlestranded DNA (ssDNA). It is frequently used in real-time PCR reactions to quantify reaction products. Taqman Probe: A fluorescently tagged primer complementary to the target sequence. The 5 'end of the primer carries the "reporter dye" whose emission is subdued by the quenching dye at the 3' end. Removal of the reporter dye by Taq DNA polymerase creates a green fluorescence. Taq Polymerase: A heat stable DNA polymerase from Thermos aquaticus. Its 5'-3' exonuclease activity is used with FRET to enable detection of PCR products in real time. Thermocycler: A programmable instrument that automates PCR by repeatedly cycling through the various temperatures needed to denature dsDNA, anneal primers and polymerase new DNA. March 19, 2012 MCB263 Winter 2003--Biotechnology: Fundamentals and Applications 12 Polymerase Chain Reaction (PCR) PCR is an in vitro method for producing large amounts of a specific DNA fragment of defined length and sequence, from small amounts of a complex template. PCR was first conceived in April 1983 by Dr. Kary Mullis, (1993 Nobel Laureate) although the components and principles underlying PCR have been known since 1968. Because of its sensitivity, speed, and versatility, PCR has become an important tool in molecular biology. Some other applications of PCR include: q DNA fragment isolation; fragment labeling; mutagenesis; cDNA cloning; genomic cloning, genomic mapping; RNA and DNA quantitation and DNA sequencing. PCR is also used in human genetics, forensic science, and evolutionary and developmental biology and epidemiology. BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 13 March 19, 2012 Some examples of PCR's capabilities Target sequences can be amplified from 10-23 moles to 10-12 moles, a 1011 fold amplification. 20 cycles produces 1 million copies, 30 cycles, 1 billion PCR can amplify target sequences up to 3g/100l. PCR can detect one copy of target sequence in 106 genomes. PCR can amplify from a single DNA molecule (e.g., single sperm or hair root). Although PCR routinely amplifies up to 10kb, products as long as 50 kb have been reported. PCR has amplified DNA fragments from the tissue of a 28,000 year old frozen woolly mammoth and 400,000 year old plants from Greenland. BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 14 March 19, 2012 PRC Quantification? Theoretically, PCR is quantitative. Starting with a fixed amount of substrate, exponential doubling should give a predicable and quantitative amount of DNA. But it doesn't! BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 Typical PRC Template and 5 Essential Questions 1 10 20 30 40 50 60 5'ATGTTTGACAGCTTATCATCGATAAGCTATAATGCGGCTAGTTTATCACAGTTAGATTGC 3' AGTGTCAATC 5' 3' Target Sequence TGACAGCTTA 3' 5' TACAAACTGTCGAATAGTAGCTATTCGATATTACGCCGATCAAATAGTGTCAATCTAACG 5' 3' Target Sequence (30bp) 1. What are the chemical polarities of the forward primer shown above? 2. What are the chemical polarities of the reverse primer? 3. What are the chemical polarities of the template strands? 4. What is the location and size of the target sequence? 5. What is the size of the desired PRC product? March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 16 The Typical PRC Reaction Mixture 1 10 20 30 40 50 60 5'ATGTTTGACAGCTTATCATCGATAAGCTATAATGCGGCTAGTTTATCACAGTTAGATTGC3' 3' AGTGTCAATC 5' 5' TGACAGCTTA 3' 3'TACAAACTGTCGAATAGTAGCTATTCGATATTACGCCGATCAAATAGTGTCAATCTAACG5' Target Sequence (30bp) 1.0 l DNA template (100 ng/l) 1.25 l of each primer pair (@ 100 ng/l) 2.5 l total 1.0 l Taq DNA-Polymerase 1.0 l each of the 4 deoxynucleotide triphospates 5.0 l 10X buffer 4 l 25mM MgCl 85.5 l H2O A 200 l reaction tube containing the 100 l mixture is inserted into the thermocycler. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 17 The Typical PRC Reaction Protocol Step 1 -- Melting. The mixture is heated to 95-96C for 5 minutes to ensure that the DNA strands as well as the primers have melted. The DNAPolymerase can be present at initialization, or it can be added after this step. For each subsequent cycle, 30 seconds at 96C is usually enough time for the DNA to denature. Step 2 -- Annealing. By reducing temperature to 68C for 30 seconds primers can anneal to target sequence in single stranded DNA. Step 3 -- Elongation. If DNA polymerase is present, deoxynucleotides can be elongation at 72C for 45 seconds. Steps 1-3 -- Cycling. With sufficient primers and heat stable DNA polymerase these steps can be repeated from 15 to 30 times, (usually 20 cycles is sufficient). Step 4 -- Termination. Mixture is held at 4 to 7C until it can be analyzed by gel electrophoresis. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 18 Polymerase Chain Reaction Movie http://www.youtube.com/watch?v=eEcy9k_KsDI March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 19 Typical End-Point PRC Results Agarose gel (1%) electrophoresis stained with ethidium bromide and illuminated with UV light to visualized fluorescing DNA bands. The center lane shows DNA markers that increase by increments of 100bp. To the left are different PCR products using different primer pairs. To the right are control reactions using primers for the -actin gene. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 20 Automating PCR with thermostable DNA polymerases Taq DNA polymerase 94kDals. Single polypeptide Purified from Thermus aquaticus YT1. Thermo stable up to 95 C. 5' 3' DNA polymerase and exonuclease activity Lacks 3' 5' exonuclease Used with PCR thermocyclers March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 21 DNA polymerase Error Rates Enzyme Phusion (NEB proprietary) T4 Polymerase (E. coli bacteriophage ) Pfu (Pyrococcus furiosus) DNA Pol I (E. coli ) Klenow Fragment (E. coli ) Vent (Thermococcus litoralis) Klenow Fragment (E. coli ) Taq (Thermus aquaticus) Vent (Thermococcus litoralis) 1 Error per 106 bases 0.44 >1 >1 9 18 10-50 100* 110 * 500* * Lacking 3' 5' exonuclease http://www.neb.com/nebecomm/tech_reference/polymerases/properties_dna_polymerases.asp March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 22 ...
View Full Document

This note was uploaded on 03/18/2012 for the course BIS 101 taught by Professor Simonchan during the Winter '08 term at UC Davis.

Ask a homework question - tutors are online