09BIS1012012TransciptLect9

09BIS1012012TransciptLect9 - BIS101-001: Genes and Gene...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: BIS101-001: Genes and Gene Expression Transcription, RNA Synthesis and Gene Expression: Chapter 8 Lecture #9 March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 1 Last Lecture Topics: Initiation of DNA Replication: Replication begins at a distinct origin or origins. Elongation of DNA Replication: The machinery that polymerizes deoxynucleotides in the 5' to 3' direction. Termination of DNA Replications: Replicating the ends of linear DNA molecules create a the problem of overhanging 3'OH groups. In human chromosomes these overlapping ends are called telomeres. Telomeres are repetitive DNA sequences. The enzyme, telomerase is a small nuclear ribonuceloprotein or SNRP. The small RNA in telomerase uses the repetitive DNA sequences to extend the chromosomes ends. PCR: Polymerase Chain Reaction or PCR revolutionized molecular biology and genetics. A rapid, sensitive and quantitative method for isolated DNA fragments based on the sequential priming and synthesis of DNA a target DNA sequence in vitro. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 2 This Lecture: Key Concepts DNA is copied into an RNA by the process of transcription. RNA is used to make protein (messenger RNA) or used as structural components for other macromolecules like ribosomes. Transcription and DNA replication are related in several ways. The rules and components for transcription are similar to those of DNA synthesis. Special sequences in the DNA signal the initiation and termination of the transcription process. In eukaryotes, the initial RNA transcript (heterogeneous nuclear RNA -- hnRNA) is processed in several way to generate the final mRNA. Many eukaryotic genes contain intervening DNA sequences, called "introns" that must be spliced out of the corresponding hnRNA. HnRNA can be spliced in several ways. One method requires the action of an RNA-containing enzyme called a splicosome. BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 3 March 19, 2012 Central Dogma of Molecular Biology Reverse transcriptase Initiation Elongation Termination March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 4 Transcription/Replication Transcription and DNA replication are linked genetically and biochemically. Genes for RNA polymerase are mixed in with genes for replication and translation and co-transcribed (a "regulon"). 66' rpsU dnaG (S21) primase rpoD 67' subunit 70kD 72' rpoA rpsD rpsK rpsM 71' rps subunit 40kD 84' 88' rplJ rplL rpoB rpoC 89' & ' subunits 151kD 155kD E. coli origin of DNA replication - Ori C March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 5 Transcription Because DNA does not participate directly in the synthesis of the gene product (usually a protein), an intermediate information-containing molecule is needed. This molecule is called messenger RNA (mRNA) and is synthesized by a DNA-dependent RNA polymerase (RNAP). In prokaryotic cells like E. coli, there is only one type of RNAP responsible for transcribing genes. In eukaryotic cells, three RNAPs are involved in transcription: RNAPI transcribes ribosomal or rRNA, RNAPII transcribes mRNA and RNAPIII transcribes transfer RNA (tRNA). In vivo, mRNAs are differentially degraded by ribonucleases giving each type of mRNA a specific half-life. The average half-life of mRNA in E. coli, yeast, and humans are 4 minutes, 20 minutes and 10 hours, respectively. The transient nature of mRNA provides a mechanism for genes to be differentially expressed or regulated. This means that a gene can be turn on when needed and turned off when not needed. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 6 Evidence for RNA as an Intermediate Messenger Caspersson and Brachet (1950) demonstrated that mRNA synthesis and protein synthesis occur concomitantly in the cell. David Prescott's pulse/chase experiments using 3H-cytidine and autoradiography showed that RNA was made in the nuclease and transported to the cytoplasm. Protein synthesis can occur in the absence of DNA synthesis but not in the absence of RNA synthesis. RNA isolated from a particular cell can hybridize with ssDNA from that cell to form a heteroduplex. The base composition of RNA is generally similar to the base composition of the DNA from which it is made. Base Composition A T or U G C March 19, 2012 E. coli DNA 25% 25% 25% 25% E coli RNA 23% 23% 31% 23% T2 DNA 32% 32% 18% 18% T2RNA 31% 29% 20% 18% 7 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 Evidence for RNA as an Intermediate Messenger David Prescott's pulse/chase experiments using 3H-cytidine and auto-radiography showed that RNA was made in the nuclease and transported to the cytoplasm. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 8 Rules & Requirements for specific gene transcription Double-stranded DNA (dsDNA) The 4 ribonucleotide triphosphates ATP, CTP, GTP and UTP A regulatory DNA sequence called a "promoter" RNAP holoenzyme (core + ) 5'-3' de novo polymerization March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 9 Structure of Bacterial RNAP Holoenzyme RNAP holoenzyme is a multi-component enzyme consisting of at least 5 subunits. The structure of the holoenzyme can be expressed as: 2 ' (480kD). Without the subunit, RNAP is referred to as "core polymerase" and it capable of elongation of RNA synthesis and nonspecific transcription of DNA. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 10 RNAP Holoenzyme RNAP holoenzyme is a multi-component enzyme consisting of at least 5 subunits. The structure of the holoenzyme can be expressed as: 2 ' (480kD). Without the subunit, RNAP is referred to as "core polymerase" and it capable of elongation of RNA synthesis and nonspecific transcription of dsDNA. March 19, 2012 ' ' ' RNAP holoenzyme BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 11 Sense Transcription Sigma is needed for specific transcription. The DNA strand that is transcribed is called the "template" (transcribed) strand as opposed to the "nontemplate" (non-transcribed) strand. The non-template DNA strand is also called the "RNA-like strand" because it is identical in sequence to the newly made RNA molecule. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 12 Sense and Antisense Strands 5'A G C C T A T T G G G A T C T A T T A A T C C C3' non-template, nontranscribed or sense strand template, transcribed or antisense strand 3'T C G G A T A A C C C T A G A T A A T T A G G G5' 5'A G C C T A T T G G G A T C T A T T A A T C C C3' sense strand RNA 5'A U U G G G A U C U A U U A A U C C 3'T C G G A T A A C C C T A G A T A A T T A G G G5' 5'A G C C T A T T G G G A T C T A T T A A T C C C3' C C C U A G A U A A U U A G G G5' antisense strand RNA 5'A U U G G G A U C U A U U A A U C C 3'T C G G A T A A C C C T A G A T A A T T A G G G5' March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 13 Transcription Initiation Because the subunits of RNAP are positively charged (rich in arginine and lysine), it has a natural affinity for negatively charged DNA. However, it is the interaction between the subunit and the promoter sequence that enables RNAP to recognize and transcribe genes. The steps in initiation are as follows: RNAP binds the promoter sequence without strand separation (closed complex), DNA strands separate to form an open complex in the promoter The template strand is selected by subunit, H bonding between complementary dexoynucleotides and ribonucleotides, A phosphodiester bond forms a between the first and second ribonucleotide, RNAP begins moving in the 5' to 3' direction down the gene After 5 to 8 bases, the subunit dissociates from the RNAP leaving the core polymerase (E) to transcribe the DNA. The free subunit forms a new holoenzyme (E) with another core polymerase. E + DNA KB EDNAclosed + Mg2+ Ki K2 EDNAopen EDNAopen + NTP March 19, 2012 EDNA + RNA + 14 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 RNAP Promoter Binding http://bioweb.wku.edu/courses/biol22000/18TranscInitProk/default.html March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 15 Initiation of Transcription Elongation Nucleotide Site (ENS) Primer Terminus Site (PTS) March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 16 Deacetylation of Chromatin March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 17 Transcription (Movie) http://www.youtube.com/watch?v=rRoqfoLuu0o March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 18 Transcription (Movie) March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 19 Transcription (Movie) http://www.dailymotion.com/video/xfr7q4_dna-and-rna-transcription-video-real-time-dna-encoding-pr_news March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 20 Promoter Structure and Function Promoters were first defined genetically by Jacob and Monod as cisacting mutations that mapped to the 5' side of the lacZ gene of E. coli. Some of these mutations resulted in a decrease in lac mRNA and were therefore called "down promoter mutations." Our first impressions of the physical structure of the promoter came in 1975 when David Pribnow sequenced RNAP-protected DNA fragments to define the size and nucleotide sequence of the three bacteriophage T7 promoters. RNAP was bound to the T7 promoters and locked down with the dinucleotide 5'pppGpA. T7 DNA RNAP + dinucleotide 5'pppGpA March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 21 Promoter Structure: The Pribnow Experiment DNase was added to the T7 DNA and small DNA fragments (RNAP protected DNA) were produced. The RNAP was striped with phenol, cleaned and sequenced. Pribnow identified three conserved sequences with fairly fixed spacing; (1) -35 region, (2) the -10 or Pribnow box; and (3) the +1, the initiation nucleotide + DNase GTTACA TATPuATG Pu -35 -10 +1 +18 March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 22 The Consensus Promoter Hundreds of prokaryotic promoters have since been sequenced and found to have highly conserved regions that correspond to the Pribnow's +1, -10 and -35 sequences. This has led to the concept of a consensus promoter sequence (Fig. 8-12). A concensus promoter sequence is a hypothetical sequence based on the most commonly occurring nucleotides at a particular position. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 23 Consensus Promoters and Mutations In the sequence shown below, upper and lower case letters represent nucleotides that appear that in the promoter sequence, less than (lower case) and more than (upper case) 50% of the time. Subscript numbers represent percentages of occurrence while numbers above the sequence refer the conserved regions identified by Pribnow. Mutation analysis has shown that these conserved regions are required for the promoter function. Upward arrows in the second row refer to enhanced transcription, down arrows refer to mutations that decrease transcription. Mutation that change the sequence toward consensus increase transcription. -35 -10 +1 ctT82T84G78A65C54a45-----15 to 18 bp--------T80A95t45A60a50T96--4 to 9 bp---cat-(iq) T C T (UV5) A A C T C G T +1 t c T T G A C a -------(15 to 18 bp) --------T A t A a T -----------c a t-----A A T A G T C C A 24 March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 Example of 3 Common Bacterial Promoters 35 10 +1 5'CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCAC 3'GGTCCGAAATGTGAAATACGAAGGCCGAGCATATTACACACCTTAACACTCGCCTATTGTTAAAGTG SD site Met ACAGGAAACAGAATTCTATG3' TGTCCTTTGTCTTAAGATAC5' E. coli lac UV5 35 10 +1 5'GAATTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCT 3'CTTAAGAGTACAAACTGTCGAATAGTAGCTATTCGAAATTACGCCATCAAATAGTGTCAATTTAACGA SD site Met AACGCAGTCAGGCACCGTGTATG3' TTGCGTCAGTCCGTGGCACATAC5' pBR322 Tetracycline Resistance 35 10 +1 5'TATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCT 3'ATAAACAAATAAAAAGATTTATGTAAGTTTATACATAGGCGAGTACTCTGTTATTGGGACTATTTACGA SD site Met TCAATAATATTGAAAAAGAAGAGTATG3' AGTTATTATAACTTTTTCTTCTCATAC5' March 19, 2012 pBR322/pUC19 Ampicillin Resistance 25 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 Transcription Elongation After the RNAP holoenzyme moves 5 to 8 bases away from the promoter, the factor dissociates from the RNAP and the core RNAP completes transcription. Elongation takes place at a rate of about 40 to 60 bases/sec and pauses occasionally at GC rich regions. The significance of this pausing is not clear. As the RNAP core enzyme transcribes the gene, the helix is unwound 18 to 30bp and a DNA/RNA hybrid of 12 to 17 bp is formed within this denatured bubble in the DNA. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 26 EM of E. coli Transcription The electron micrograph (EM) at the right shows multiple transcription initiation events. As the mRNAs grow in length, ribosomes attached to begin protein synthesis (translation). The length of mRNA indications the direction of transcription. March 19, 2012 Promoter BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 27 Transcription Termination There are 3 stages to the termination stage: (1) cessation of RNA synthesis; (2) release of the newly made RNA and (3) dissociation of the RNAP from the DNA. This can be accomplished either with the help of a protein called "rho" ( ), or in a rho-independent fashion. In the latter case, intramolecular complementarity (an inverted-repeat sequence or palindrome) in the DNA produces a hair-pin loop in the RNA. The DNA/RNA hybrid at the end of this palindrome consists of a series of U=A base pairs, which are the most unstable (lowest - G value) of all possible base pair combinations. The weakness of these bonds causes the RNA to dissociate from the DNA and pull out March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 of the RNAP-DNA complex. 28 Rho-dependent Termination Rho-dependent termination involves the binding of rho protein to the rho utilization or rut site on the RNA and movement toward the terminator. Rho acts as a homohexameric protein (46kD x 6) with an RNAdependent ATPase activity. The hydrolysis of ATP by rho may help unwind the RNA/DNA hybrid at the end of the gene. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 29 Summary DNA is copied into an RNA by the process of transcription. RNA is used to make protein (messenger RNA) or used as structural components for other macromolecules like ribosomes. Transcription and DNA replication are related in several ways. The rules and components for transcription are similar to those of DNA synthesis. Special sequences in the DNA signal the initiation and termination of the transcription process. March 19, 2012 BIS101001, Spring 2012--Genes and Gene Expression, R.L. Rodriguez 2012 30 ...
View Full Document

Ask a homework question - tutors are online