Bio 224 Bioinformatics Molecular Data

Bio 224 Bioinformatics Molecular Data - Lepisosteus oculatus

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Lepisosteus oculatus >gi|38304785|gb|AY442350.1| Lepisosteus oculatus mitochondrion, complete genome GCTAGTGTAGCTTAACCAAAGCATAGCACTGAAGATGTTAAGATGGACTCTAACGGGTCCCACGGGCRCA AAGGCTTGGTCCTGACCTTGCTATCAGTTTTAGCCGAACTTACACATGCAAGTATCCGAGGTTTGGTCCT GACCTTGCTATCAGTTTTAGCCGAACTTACACATGCAAGTATCCGCACCCCTGTGAGAATGCCCTTCAAA CCCTAAGCAGGAGATAAGGAGCAGGCATCAGGCACACGACCCGTAGCCCAAGACGCCTTACTTAGTCAC A CCCCCAAGGGAACTCAGCAGTGATAAACATTAAGCAATAAGCGAAAGCTTGACTTAGTTAAAGCTAAGA G AGCCGGTAAAACTCGTGCCAGCCACCGCGGTTATACGAGAGGCTCCAACTGATAGCCCACGGCGTAAAG C GTGATTATAGGATGCTGCCCCAACTAAAGTCAAAATCTCCCTAAGCCGTCATACGCACTTGGGAGCATGA AGCCCCTCCACGAAGGTAACTTTATAGCCTACAGCCACCCTGAACTCACGATAGCTAAGACACAAACTGG GATTAGATACCCCACTATGCTTAGCCCTAAACCTAAATAATAGAATACAAATATTATCCGCCAGGGGACT ACAAGCGCCAGCTTAAAACCCAAAGGACTTGGCGGTGTCCCAAACCCACCTAGAGGAGCCTGTTCTAGAA CCGATATTCCCCGTTAAACCTCACCACTTCTTGTCAATCCCGCCTATATACCGCCGTCACCAGCTTACCC TGTGAAGGAAAAACAGTGAGCAAAAAGGGGACACCCCAAAACGTCAGGTCGAGGTGTAGCGTATGAAGT G GAAAGAAATGGGCTACATTTTCTATGTCAGAATATTACGAACAACACCATGAAATTGGTATTTTAAGGTG GATTTAGCAGTAAAAAGAAAATAGAGAGTTCTTTTGAAGTTGGCTCTGGGACGCGTACACACCGCCCGTC ACCCTCCTCGAATTGAACCTACTTAACTTAATAAACAGAAAGCCAGAACAAGAGGAGGCAAGTCGTAAC A CGGTAAGTGTACCGGAAGGTGCACTTGGAATAACCAAAGCGTGGCTGAGAAGGAAAGCGTCTCCCTTAC A CTGAGAAGACATCCATGCAAATTGGATCGCTTTGAGCCATACAGCTAGCCAAACCAATATCTTAACTTAC AAATATACATAACCCCATAAATTTTTAAAGACCTAAACCAAATCATTTGTACCCCCAGTATAGGCGATAG AAAAGGAAAATTTTGAGCAATAGAAAACAGTACCGCAAGGGAAAGCTGAAAAAGAAATGAAACAACCC AT CAAAGCACTAAAAAGCAGAGATTAAATCTCGTACCTTTTGCATCATGATTTAGCCAGTCTAACCAGGCAA AGAGAACTTAAGTCTGCCTTCCCGAAACTAGACGAGCTACTCCGAGACAGTCTACCAGGGCTAATCCGTC TCTGTGGCAAAAGAGTGGAAAGATCTCCGAGTAGCGGTGACAGACCTAACGAGTCTAGTGATAGCTGGTT GCTTAGGAAACGAATATTAGTTCAGCCTCAAGACATGCTCCTAACCGCCCCAAGTACTTACTTCACCAAG GCACTCGATAATCTTGAGAGTTACTCAAAGGAGGTACAGCTCCTCTGAGAAAGAACACAACCTTAATAGA TGGATAAAGATCATAACATAACAGGACTTCCCGCTCCAGTAGGCCTAAAAGCAGCCACCTGCACAGAAA G CGTTAAAGCTCAGGCAGAAGCCATCCAATTATAACGACAAATACATCTGACTCCTCCTAATACTACTAAG CTACTCTATTTTTATAGAAGAAATAATGCTAAAATCAGTAATAAGAAGGCACGACCTTCTCCAAGCATAC GTGTAAGTCAGATCGGACACACCACTGACAAATAACGAACCCAACCAAAGAGGGCAATATTTATATATCC TAAACAAGAAAAGCTTATTAAATATTAATCGTTAACCTTACACAAGAATGCACATGGAAAGACTAAAAG A AAAAGAAGGAACTCGGCAACCCCGAGCCTCGCCTGTTTACCAAAAACATCGCCTCTTGCAAACACCGAAG TATTAGAGGTCCCGCCTGCCCTGTGACTTAGTTTAACGGCCGCGGTATTTTGACCGTGCGAAGGTAGCGT AATCACTTGTCTTTTAAATGAAGACCGGTATGAATGGCATCACGAGGGCTCACCTGTCTCCTTTTTCCAG TCAATGAAATTGATCTGCCCGTGCAGAAGCGGACATGTAAACATAAGACGAGAAGACCCTATGGAGCTT A AAACACAAGACCAACCACGCCAGTAACCCAATTGCTCGAAAGACATAAAAAATACAAAGCACAGTGGTC T CTGGTCCTAATGTTTTCGGTTGGGGCGACCACGGAGAAAAATAAAACCTCCACGTCGATTGGAGATAACC TCTAAAACCAAGAGCAACAACTCTAAGTAACAGAAAATCTGACGATAAATGACCCAGACCTGTCTGATCA ACGAACCAAGTTACCCTAGGGATAACAGCGCAATCCTTTCCCAGAGTTCCTATCGACGAAAGGGTTTACG ACCTCGATGTTGGATCAGGACATCCTAATGGTGCAGCAGCTATTAAGGGTTCGTTTGTTCAACGATTAAA GTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCAGTTTCTATCTATGCAATGACTCTTTCTAG TACGAAAGGATCGAAAGAAGGGGGCCTATTCTTCAAGCACGCCCCATCCTCATTCACTGAACACAACTAA AATGAAAAAGAGGACATATCATTAATACCCCAAAAAAGGGTACAGCTGAAGTGGCAGAGCTTGGTAATT...
View Full Document

This note was uploaded on 03/18/2012 for the course BIO 224 taught by Professor Staff during the Winter '12 term at Drexel.

Page1 / 13

Bio 224 Bioinformatics Molecular Data - Lepisosteus oculatus

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online