Bio 142 - Week 2 slides - Sp12-4

Bio 142 - Week 2 slides - Sp12-4 - PCR and Bioinformatics:...

Info iconThis preview shows pages 1–9. Sign up to view the full content.

View Full Document Right Arrow Icon
PCR and Bioinformatics: Tools you can use!
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
How does Polyermase Chain Reaction (PCR) work? 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT ACG 5’ What do you need in a PCR reaction? DNA template DNA primers (forward and reverse) DNA Polymerase dNTPs (mixture of dATP, dCTP, dGTP, dTTP) buffer L. Mclane and A. Escobar The instrument used for PCR is called a thermocycler.
Background image of page 2
PCR First Step is? Denaturation of DNA at approximately 95 o C Separation of DNA strands 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT ACG 5’ L. Mclane and A. Escobar Sequence of interest for amplification…What is this region? STR region!
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
PCR Second Step is? Annealing of primers at 55-65 o C 5’ GCACCTAG 3’ 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT ACG 5’ 3’TGGACCCAT 5’ Forward = left primer Reverse = right primer L. Mclane and A. Escobar
Background image of page 4
Designing effective primers Primer length: 18-24 nucleotides Longer = less efficient annealing Shorter = less specific annealing • Melting temperature T M – Both primers should have a similar T M – not more than 5 o C apart – T M = temperature at which half the primers are bound Annealing temperature you set should be 5 o C lower than the T M L. Mclane and A. Escobar
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Designing effective primers Specificity – more specific primer sequence = more efficient PCR reaction Complementary primer sequence – primer- dimers form when a primer anneals to itself or another primer G/C content – ideally, 45-55%; more G/C causes increase in T M 3’ end sequence – adding a G or C to last 3 nucleotides increases efficiency L. Mclane and A. Escobar
Background image of page 6
PCR Third Step is? Extension by DNA Pol at approximately 72 o C 5’ GCACCTAG 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT ACG 5’ TGGACCCAT 5’ TaqPo l TaqPo l L. Mclane and A. Escobar Primers bind so that DNA is synthesized in the 5’ 3’ direction Special polymerase for PCR = Taq polymerase Can withstand high heat (i.e. 95 o C denaturing step)
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
By the end of the third cycle you should have 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT ACG 5’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT 5’ 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ L. Mclane and A. Escobar
Background image of page 8
Image of page 9
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/02/2012 for the course BIO 142L taught by Professor Conniearthur during the Spring '12 term at Emory.

Page1 / 36

Bio 142 - Week 2 slides - Sp12-4 - PCR and Bioinformatics:...

This preview shows document pages 1 - 9. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online