{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Bio 142 - Week 2 slides - Sp12-4

Bio 142 - Week 2 slides - Sp12-4 - PCR and Bioinformatics...

Info icon This preview shows pages 1–9. Sign up to view the full content.

View Full Document Right Arrow Icon
PCR and Bioinformatics: Tools you can use!
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
How does Polyermase Chain Reaction (PCR) work? 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT ACG 5’ What do you need in a PCR reaction? DNA template DNA primers (forward and reverse) DNA Polymerase dNTPs (mixture of dATP, dCTP, dGTP, dTTP) buffer L. Mclane and A. Escobar The instrument used for PCR is called a thermocycler.
Image of page 2
PCR First Step is? Denaturation of DNA at approximately 95 o C Separation of DNA strands 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT ACG 5’ L. Mclane and A. Escobar Sequence of interest for amplification…What is this region? STR region!
Image of page 3

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
PCR Second Step is? Annealing of primers at 55-65 o C 5’ GCACCTAG 3’ 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT ACG 5’ 3’TGGACCCAT 5’ Forward = left primer Reverse = right primer L. Mclane and A. Escobar
Image of page 4
Designing effective primers Primer length: 18-24 nucleotides Longer = less efficient annealing Shorter = less specific annealing Melting temperature T M – Both primers should have a similar T M – not more than 5 o C apart – T M = temperature at which half the primers are bound Annealing temperature you set should be 5 o C lower than the T M L. Mclane and A. Escobar
Image of page 5

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Designing effective primers Specificity – more specific primer sequence = more efficient PCR reaction Complementary primer sequence – primer- dimers form when a primer anneals to itself or another primer G/C content – ideally, 45-55%; more G/C causes increase in T M 3’ end sequence – adding a G or C to last 3 nucleotides increases efficiency L. Mclane and A. Escobar
Image of page 6
PCR Third Step is? Extension by DNA Pol at approximately 72 o C 5’ GCACCTAG 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT ACG 5’ TGGACCCAT 5’ TaqPo l TaqPo l L. Mclane and A. Escobar Primers bind so that DNA is synthesized in the 5’ 3’ direction Special polymerase for PCR = Taq polymerase Can withstand high heat (i.e. 95 o C denaturing step)
Image of page 7

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
By the end of the third cycle you should have 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT ACG 5’ 3’ ACGTGGATCATGATGATGATGATG TGGACCCAT 5’ 5’ TGCACCTAGTACTACTACTACTAC ACCTGGGTATGC 3’ L. Mclane and A. Escobar
Image of page 8
Image of page 9
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern