Lecture15-S11

Lecture15-S11 - 3’-GCTACAGCCCTAGTTGTGTTCCTCACTTGACCTC...

Info iconThis preview shows pages 1–27. Sign up to view the full content.

View Full Document Right Arrow Icon
BIS 101 24 May 09 Dr. Draper’s Office Hour this week: Wednesday, May 25 3:00-4:00 pm Life Science Rm. 3002
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Regulation of gene expression by microRNAs
Background image of page 2
Regulation of gene expression by miRNAs
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Recombinant DNA Technology
Background image of page 4
Recombinant DNA Technology: Cloning
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Restriction Endonuclease Enzymes
Background image of page 6
Making a DNA Library
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Making a DNA Library
Background image of page 8
DNA Cloning Vectors
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 10
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Complementary DNA (cDNA) (converting an RNA sequence into DNA) 5’-CGAUGUCGGGAUCAACACAAGGCGUGCCAUGGAGAAAAAAAAAAAA-3’ mRNA ||||||||| 3’- TTTTTTTTT -5’ (oligo dT) DNA Primer + Reverse Transcriptase (RT) dNTPs 5’-CGAUGUCGGGAUCAACACAAGGCGUGCCAUGGAGAAAAAAAAAAAA-3’ |||||||||||||||||||||||||||||||||||||||||||
Background image of page 12
Background image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 14
Background image of page 15

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 16
Background image of page 17

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 18
Background image of page 19

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 20
Background image of page 21

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 22
Background image of page 23

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 24
Background image of page 25

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 26
Background image of page 27
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 3’-GCTACAGCCCTAGTTGTGTTCCTCACTTGACCTC TTTTTTTTT-5’ mRNA DNA Ligate Linker Oligo 3’-GCTTAAGTCTGA-Degrade RNA (RNase) GCTACAGCCCTAGTTGTGTTCCTCACTTGACCTC TTTTTTTTT-5’ Add DNA Primer 5’-CGAATTCAGACT-|||||||||||| CGATGTCGGGATCAACACAAGGCGTGCCATGGAGAAAAAAAAA ||||||||||||||||||||||||||||||||||||||||||| Add DNA Pol + dNTPs dsDNA Genetic Engineering QuickTimeª and a decompressor are needed to see this picture. Tol2 Transposon Mediated Transgenesis QuickTimeª and a decompressor are needed to see this picture. Tol2 Transposon Mediated Transgenesis Genetic Engineering in Plants Southern Blot...
View Full Document

This note was uploaded on 04/05/2012 for the course BIS 101 taught by Professor Simonchan during the Spring '08 term at UC Davis.

Page1 / 27

Lecture15-S11 - 3’-GCTACAGCCCTAGTTGTGTTCCTCACTTGACCTC...

This preview shows document pages 1 - 27. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online