202finalprac2 - 1. The following prokaryotic DNA sequence...

Download Document
Showing pages : 1 - 2 of 5
This preview has blurred sections. Sign up to view the full version! View Full Document
1. The following prokaryotic DNA sequence encodes an mRNA. a. Circle the promoter consensus sequences found on the coding strand of DNA 2 pts b. Write out the mRNA sequence encoded by this gene (indicate the 5’ and 3’ ends). 4 pts c. Translate that mRNA sequence into an amino acid sequence using the provided genetic code (indicate the N and C termini of the polypeptide). 4 pts 5’ AACATTGACACCGTAACTGTACGCTCATATATTCGATCGGCTTAGATGCCT GCTTACCGGGAGTAAGCCATCGA 3’ 3’ TTGTAACTGTGGCATTGACATGCGAGTATATAAGCTAGCCGAATCTACGGACGAATGGCCCTCATTCGGTAGCT 5’ mRNA sequence: amino acid sequence: 2. The following table shows part of the sequence of a gene, with both DNA strands, the mRNA strand and the amino acid sequence indicated. Complete the table, including all of the nucleotides and amino acids. Label the 5’ and 5’’ ends of each nucleotide strand. 2.5 pts 1 2 3 4 5 6 7 8 9 10 11 12 DNA double helix- - C G T C A T A T C AG G T T G A G A MRNA GC A U G G A Amino acids Trp Ser 3. The normal sequence of a particular protein is given here, along with several mutant versions of it. For each mutant, explain what mutation occurred in the coding sequence of the gene. Assume only a single mutational event explains each altered amino acid sequence. 4 pts (…) = multiple unspecified amino acids
Background image of page 1
* On the final, you would only be asked about one mutant. Normal: Met-Gly-Glu-Thr-Lys-Val-Val-(…)-Pro Mutant 1: Met-Gly Mutant 2: Met-Gly-Glu-Asp Mutant 3: Met-Gly-Arg-Leu-Lys Mutant 4: Met-Arg-Glu-Thr-Lys-Val-Val-(…)-Pro 4. In the replication bubble below, label all ends of newly made DNA (in bold) with either 5’ or
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Create a FREE account now to get started. Log In

The email address you entered is not valid. The email address you provided is already in use.
Your username must be at least 5 characters. Your username must consist of only alphanumeric characters. Your username must contain at least one letter. Your username contains inappropriate language. Another user has already claimed this username.
Your password must be at least 6 characters in length.
{[ $select.selected.label ]} Please select a valid school.
By creating an account you agree to our Privacy Policy, Terms of Use, and Honor Code.
Create my FREE account Processing...
Sign Up with Facebook

We will never post anything without your permission.

Already on Course Hero? Log In