Page1 / 40

Ch17 Test File-Genomes - Test File to accompany Life: The...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ch17 Test File-Genomes

Ch17 Test File-Genomes - Test File to accompany Life: The...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Test File to accompany Life: The Science of Biology, Ninth Edition Sadava • Hillis • Heller • Berenbaum Chapter 17: Genomes TEST FILE QUESTIONS (By Norman Johnson) Multiple Choice 1. The gene most responsible for differences in size among different breeds of dogs is the _______ gene. a. myostatin b. phosphofructokinase c. insulin-like growth factor d. tyrosine growth factor e. giant Answer: c Textbook Reference: 17.0 The dog genome Page: 365 Bloom’s Category: 1. Remembering 2. Increasing the activity of myostatin in a dog will most likely lead to a. increased muscle development. b. decreased muscle development. c. increased size. d. decreased size. e. a change in coat color. Answer: b Textbook Reference: 17.0 The dog genome Page: 365 Bloom’s Category: 2. Understanding 3. Which of the following statements about the Human Genome Project (HGP) is false ? a. The sequencing of smaller genomes helped in the development of methods that benefited the HGP. b. Only privately funded groups were involved in the sequencing effort. c. The HGP was in part spurred on by a desire to determine the specific DNA damage caused by radiation from the atomic blasts on Japan during World War II. d. One objective of the HGP was to identify genetic changes associated with disease. e. All of the above are true; none is false. Answer: b
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Textbook Reference: 17.1 How Are Genomes Sequenced? Page: 366 Bloom’s Category: 1. Remembering 4. The maximum length of DNA that can be sequenced at one time by means of the standard technology is about _______ bases. a. 700 b. 3,000 c. 7,000 d. 30,000 e. 70,000 Answer: a Textbook Reference: 17.1 How Are Genomes Sequenced? Page: 366 Bloom’s Category: 1. Remembering 5. Suppose a long sequence of DNA is cut with four different restriction enzymes. Which restriction enzyme should produce the fewest number of fragments? a. One that cuts at the sequence GACT b. One that cuts at the sequence GCCTCT c. One that cuts at the sequence AGTTCTAT d. One that cuts at the sequence CAGTTCTATG e. Each of these enzymes should produce roughly the same number of fragments. Answer: d Textbook Reference: 17.1 How Are Genomes Sequenced? Page: 367 Bloom’s Category: 4. Analyzing 6. A DNA sequence is cut by two different restriction enzymes (A and B). Digestion from enzyme A yields the following fragments (read 5´ to 3´): CGATAC, GTCGTCGCC, GTTATCGCGAC. Digestion from enzyme B yields the following fragments (read 5´ to 3´): CGACGTCGTCGCC, CGATACGTTATCG. What was the original sequence? a. CGACGTCGTCGCCCGATACGTTATCG b. GTCGTCGCCCGATACGTTATCGCGAC c. CGATACGTTATCGCGACGTCGTCGCC d. CGATACGTCGTCGCCGTTATCGCGAC e. None of the above Answer: c Textbook Reference: 17.1 How Are Genomes Sequenced? Page:
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.
Ask a homework question - tutors are online