BSCI Central Dogma Cell Cycle

BSCI Central Dogma Cell Cycle - Genome Organization and...

Info iconThis preview shows pages 1–8. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
Genome Organization and Size Haploid Kingdom Organism Chromosome Organization Number Number of Base Pairs Prokaryotic Virus φΞ174 1 σσ∆ΝΑ, χιρχυλαρ 5Ξ10 3 Προκαρψοτιχς ιρυσ λαμ βδα 1 δσ∆ΝΑ 5Ξ10 4 Προκαρψοτιχς ιρυσ Θβ 1 σσΡΝΑ 4ξ10 3 Προκαρψοτε Ε.χολι 1 δσ∆ΝΑ, χιρχυλαρ 4.2Ξ10 6 Προκαρψοτε Β. συβτιλισ 1 δσ∆ΝΑ, χιρχυλαρ 2Ξ10 6 Προκαρψοτε Η. ινφλυενζαε 1 δσ∆ΝΑ, χιρχυλαρ 1.8Ξ10 6 Προκαρψοτε Μ. γενιταλιυμ 1 δσ∆ΝΑ, χιρχυλαρ 5.8Ξ10 5 Αρχηεα Μ. ϕαννασχηιι 1 δσ∆ΝΑ, χιρχυλαρ 1.66Ξ10 6 Ευκαρψοτιχς ιρυσ Ποξ 1 δσ∆ΝΑ 2Ξ10 5 Ευκαρψοτιχς ιρυσ Πολιομ ψελιτισ 1 σσΡΝΑ 6Ξ10 3 Ευκαρψοτιχς ιρυσ Ινφλυενζα 8 σσΡΝΑ 9Ξ10 3 Ευκαρψοτιχς ιρυσ Ρεοωιρυσ 1 δσΡΝΑ 5Ξ10 4 Ευκαρψοτιχ Σ. χερεωισιαε 16 δσ∆ΝΑ 1.2Ξ10 7 Ευκαρψοτιχ Χ. ελεγανσ 6 δσ∆ΝΑ 8Ξ10 7 Ευκαρψοτιχ ∆. ρεριο 25 δσ∆ΝΑ 1.7Ξ10 9 Ευκαρψοτιχ ∆. μ ελανογαστερ 5 δσ∆ΝΑ 3.3Ξ10 6 Ευκαρψοτιχ Γολδφινχη 50 δσ∆ΝΑ 3Ξ10 9 Ευκαρψοτιχ Χηιχκεν 39 δσ∆ΝΑ 2.1Ξ10 9 Ευκαρψοτιχ Χορν 10 δσ∆ΝΑ 3Ξ10 10 Ευκαρψοτιχ Η. σαπιενσ 23 δσ∆ΝΑ 3.3Ξ10 9
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
E. coli K-12 Genome: 4289 ORFS 115 Structural RNAs 4.6X10 6 bp
Background image of page 4
H. sapiens 3.2 MB 23 pairs of chromosomes 20-40,000 genes
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Eukaryote genomes sequenced ye a s t 12.1 Mb fruit fly 180 Mb     wo rm     97 Mb a ra b a do ps is    125 Mb hum a n 3200 Mb Es tim a te d num b e r o f g e ne s 5,800 13,600 19,000 25,500 30,000-40,000
Background image of page 6
What does the sequence mean? TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGG TCATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTAC ATACAAAATAATACCTCAGTGTAACCTCTGTTTGTATTTCCCTTGATTAACTGATGCTGAGCACATCTTCATGTGCTTATTGACCATTAATTAGTCTTATTTGTTAAATGTCTCAAATATTTTATACAGTTTTACATTGTGTTATTC ATTTTTTAAAAAATTCATTTTAGGTTATATGTATGTGTGTGTCAAAGTGTGTGTACATCTATTTGATATATGTATGTCTATATATTCTGGATACCATCTCTGTTTCATGCATTGCATATATATTTGCCTATTTAGTGGTTTATCTTT TCATTTTCTTTTGGTATCTTTTCATTAGAAATGTTATTTATTTTGAGTAAGTAACATTTAATATATTCTGTAACATTTAATGAATCATTTTATGTTATGTTTAGTATTAAATTTCTGAAAACATTCTATGTATTCTACTAGAATTGT CATAATTTTATCTTTTATATACATTGATATTTTTATGTCAAATATGTAGGTATGTGATATTATGCACATGGTTTTAATTCAGTTAATTGTTCTTCCAGATGTTTGTACCATTCCAACATCATTTAAATCATTAAATGAAAAGCCTTT CCTTACTAGCTAGCCAGCTTTGAAAATCCATTCATAGGGTTTGTGTTAATATATTTTTGTTCTTTTTTTTCCTTTCTACTGATCTCTTTATATTAATACCTACTGTGGCTTTATATGAAGTCATGGAATAATACGTAGTAAGCCCTC TAACACTGTTCTGTTACTGTTGTTATTGTTTTCTCAGGGTACTTTGAAATATTCGAGATTTTATTATTTTTTAGTAGCCTAGATTTCAAGATTGTTTTGACGATCAATTTTTGAATCAATTGTCAATATTTTTAGTAATAAAATGAT
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 8
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/07/2008 for the course BSCI 110A taught by Professor Broadie/patton during the Spring '08 term at Vanderbilt.

Page1 / 27

BSCI Central Dogma Cell Cycle - Genome Organization and...

This preview shows document pages 1 - 8. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online