quiz 1 fall 2012 - B BIO 360 Intro to Genetics Name Quiz#1 1 The sequence of nucleotides in a mRNA is 5 3 how many amino acids long would you expect the

quiz 1 fall 2012 - B BIO 360 Intro to Genetics Name Quiz#1...

This preview shows page 1 - 2 out of 3 pages.

B BIO 360: Intro to Genetics Name: _________________________ 10/8/12 Quiz #1 1. The sequence of nucleotides in a mRNA is: 5' – AUACGGUAUGUUUACCCAUUGGUCUUGAUCUCUA – 3' in the space above, write the template strand of the DNA from which this RNA is transcribed; mark the 5’- and 3’- ends of the DNA strand. [5 pts] how many amino acids long would you expect the polypeptide chain made with this messenger to be? [2 pts] hydroxylamine is a chemical that causes mutations in DNA; it results in the occasional replacement of a G-C base pair by an A-T base pair in the DNA. When applied to the organism making the mRNA shown above, one strain was isolated in which a mutation occurred in the base which is underlined. (Assume that a G is replaced by an A.) o how many amino acids long would you expect the polypeptide chain made by the mutant to be? [2 pts] 2. 5´–CAU–3´ is a codon in mRNA that specifies the amino acid histidine (his) in position 58 in the human α -globin protein. In all answers, be sure to indicate 5’- and 3’-ends.
Image of page 1
Image of page 2

You've reached the end of your free preview.

Want to read all 3 pages?

  • Fall '12
  • MarcServetnick
  • DNA, RNA, pts

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture