2020 PROTEIN SYNTHESIS ACTIVITY new.pdf - UNDERSTANDING...

This preview shows page 1 - 2 out of 2 pages.

UNDERSTANDING PROTEIN SYNTHESIS ACTIVITY The following sequence is located in the DNA coding / sense strand; however, you must find the starting sequence in the original strand before you start completing the table. Complete the work on the interactive page; do not print out! 5-’CCTATATAGCGATGCCCTACGGTATGGCCAGTGTCCGTATTTTCTAGTGGGCA-3’ 1. Stating at the 5’ end, find and underline the promoter sequence (TATA); this is where the RNA polymerase will first attach. Continue moving from 5’ to 3’ until you reach the ATG-start triplet. That is the start of the gene , highlight the start triplet in green . 2. Section the rest of the sequence into triplets using a space between the triplets and search for one of the stop triplets (TAA, TAG, TGA). Highlight the stop triplet in red; that marks the end of the gene. Starting with the start triplet (1), number each triplet. Copy the coding triplets into the table below ( row A ). Using complementary bases, complete row B to for the complementary template strand .

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture