{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

BIMM100 Problem Set 2_JL_TAs

Below is shown your desired pcr product 5

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: therefore want to design primers to amplify the coding region of the gene by PCR. Below is shown your desired PCR product. 5’-TTGCGAATTCATGACGCTGGATCGATGCGCTAGCTACACACTTAGGCTATAAGGATCCTTAA–3’! 3’-AACGCTTAAGTACTGCGACCTAGCTACGCGATCGATGAGAGAATCCGATATTCCTAGGAATT-5’! a) Write, in the 5’-to-3’ direction, the first four nucleotides of the two primers that you would use to produce the PCR product shown above. (4) b) Below are shown schematics of a 1,500bp PCR product and the pUC18 plasmid, with important restriction sites and their position in parentheses. You clone the PCR product between BamHI and EcoRI sites of pUC18. Plasmid PCR product EcoRI (1) NotI (500) 1,500bp BamHI (1,500) Important features of pU i) !-lactamase gene (bla) confer resistance to ampi ii) MCS for inserting gene iii) promoter upstream of MCS for expression of ins genes iv) lacZ!, a lacZ gene fragment that enables “blue/white” screening For each lane of the agarose gel below, show the bands that will result from digesting your plasmid Blue/white screening, which nd EcoRI sites) with in pUC18, enables (pUC18 with your PCR product inserted between BamHI ais conferred by the lacZ genethe indicated easy identification of restriction enzymes. On the left and right sides of bacteria carryingDNA ladders to servecolonies contain a pUC18 plasmid the gel are plasmids with inserts – blue as comparison. WITHOUT an insert, and white colonies contain a pUC18 plasmid WITH an insert. Here’s how it As shown above, the insert PCR product is 1,500bp, and pUC18 plasmid is 2,500bp. (8) works: Lane 1 Lane 2 Lane 3 Lane 4 !-galactosidase (lacZ) is an enzyme that catalyzes the hydrolysis of complex EcoRI + HindIII + HindIII + carbohydrates. This enzyme can be split into two peptide fragments: lacZ! (short) and DNA ladder HindIII BamHI DNA ladder lacZ" (long), neither of which is active by itself, but the two fragments can s...
View Full Document

{[ snackBarMessage ]}

Ask a homework question - tutors are online