{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

A 127 b 238 c 35 6 d 35 e 17

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: repaired. CGATTGCC_ ATTGGCACAGT GCTAACGGCTAACCGTGTCA Which of the following is false? a. The mutation will be repaired through base excision repair b. The mutation created an apurinic site c. The repair needs DNA polymerase and ligase d. The repair needs AP endonuclease e. The mutation created an apyrimidinic site Questions 15 ­17: Shown below is Gene B. A nucleotide change in Gene B led to a change from UAG to UAC. Which of the following is correct regarding the phenotypic impact of the mutation? 4 15. A change in the size of the protein will result if the mutation is located in? a. #1,#2,#7 b. #2,#3,#8 c. #3,#5, #6 d. #3,#5 e. #1,#7 16. A change in the amount of the protein will result if the mutation is located in? a. #1,#2,#7 b. #2,#3,#8 c. #3,#5.#7 d. #3,#5 e. #1,#7 17. A change in the amount of the mRNA will result if the mutation is located in? a. #1,#2,#7 b. #2,#3,#8 c. #3,#5.#7 d. #3,#5 e. #1,#7 Questions 18 ­19: Select the choice (a ­e) which would best describe the predicted phenotype of the genotypes given below. 18. i+ p+ o+ z+ y+ / i+ p+ oc z+ y+ β ­galactosidase (Z) permease (Y) Lactose = Present absent present absent a. + + + + b.  ­  ­  ­  ­ c. +  ­ +  ­ d. +  ­ + + e. + +  ­  ­ 5 19. is p+ o+ z+ y ­ / i+ p+ o+ z ­ y+ β ­galactosidase (Z) Permease (Y) Lactose = Present absent present absent a. + + + +...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern