Practice final exam

A 127 b 238 c 35 6 d 35 e 17

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: repaired. CGATTGCC_ ATTGGCACAGT GCTAACGGCTAACCGTGTCA Which of the following is false? a. The mutation will be repaired through base excision repair b. The mutation created an apurinic site c. The repair needs DNA polymerase and ligase d. The repair needs AP endonuclease e. The mutation created an apyrimidinic site Questions 15 ­17: Shown below is Gene B. A nucleotide change in Gene B led to a change from UAG to UAC. Which of the following is correct regarding the phenotypic impact of the mutation? 4 15. A change in the size of the protein will result if the mutation is located in? a. #1,#2,#7 b. #2,#3,#8 c. #3,#5, #6 d. #3,#5 e. #1,#7 16. A change in the amount of the protein will result if the mutation is located in? a. #1,#2,#7 b. #2,#3,#8 c. #3,#5.#7 d. #3,#5 e. #1,#7 17. A change in the amount of the mRNA will result if the mutation is located in? a. #1,#2,#7 b. #2,#3,#8 c. #3,#5.#7 d. #3,#5 e. #1,#7 Questions 18 ­19: Select the choice (a ­e) which would best describe the predicted phenotype of the genotypes given below. 18. i+ p+ o+ z+ y+ / i+ p+ oc z+ y+ β ­galactosidase (Z) permease (Y) Lactose = Present absent present absent a. + + + + b.  ­  ­  ­  ­ c. +  ­ +  ­ d. +  ­ + + e. + +  ­  ­ 5 19. is p+ o+ z+ y ­ / i+ p+ o+ z ­ y+ β ­galactosidase (Z) Permease (Y) Lactose = Present absent present absent a. + + + +...
View Full Document

Ask a homework question - tutors are online