February_6_2013_NKW

1 x 103 nt disite 4 2 x 108 nt changessite 13750 why

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: an be used to calculate popula?on size Why the discrepancy? Reflects small popula1on size during recent human history 1 million years ago to the origin of human agriculture about 10,000 years ago. 0.012 substitutions/site 2*0.001 substitutions/site/million years 6 million years! NEUTRAL THEORY 6 Using polymorphism to measure Ne in humans (effective population size over time) In humans, average silent site heterozygosity is 0.0011 differences per site. Mutation rate is 2 x 10-8 changes per site per generation. What is the effective population size (Ne)? π  = 4Neµ Ne = π /4µ =( 1.1 x 10 ­3 nt diff/site) / (4)( 2 x 10 ­8 nt changes/site) = 13,750 Why so small? " (Current census population size is 7 Billion about 500,000 times greater) 7 Nucleotide diversity can be used to measure population variation Measuring heterozygosity with DNA sequence data under the infinite sites model " Example: let L=20, S=3, and n=4. AGCGGTGTCACTAATGCGGA! AGCGGTGTCACTAGTGCAGA! AGCGGTGCCACTAGTGCAGA! AGCGGTGCCACTAGTGCGGA! •  Nucleotide diversity (π) π  is the pairwise di...
View Full Document

Ask a homework question - tutors are online