1 sequence alignment mutations at the dna level

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: :|..:||..::::.|.||.|||||||||||||.:||::|||||||||||
 ! 1 Sequence alignment Mutations at the DNA level AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Definition "Given two strings "v = v1v2...vm, w = w1w2…wn, "an alignment is an assignment of gaps to positions "0,…,m in v, and 0,…,n in w, so as to line up each " "letter in one sequence with either a letter, or a gap "in the other sequence Deletion Substitution SEQUENCE EDITS …ACGGTGCAGTTACCA… …AC----CAGTCCACCA… REARRANGEMENTS Inversion Translocation Duplication Scoring an alignment Number of pairwise alignments •  A simple scoring scheme: •  Given sequences of length m and n, the number of alignments is: •  Penalize mismatches by –μ •  Penalize indels by –σ, •  Reward matches with +1 min(m,n) ￿ ￿ •  Resulting score: #ma...
View Full Document

Ask a homework question - tutors are online