Lecture_3_motifs

The individual sequences namely the mof acgtacgt

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Gold Bug problem. Similari,es (con,nued) •  Mo0f Finding: –  Knowledge of established mo,fs reduces the complexity of the problem •  Gold Bug Problem: –  Knowledge of the words in the dic,onary is highly desirable Similari,es (con,nued) •  Mo0f Finding: –  In order to solve the problem, we analyze the frequencies of pa]erns in the nucleo,de sequences –  In order to solve the problem, we analyze the frequencies of pa]erns in the nucleo,de sequences •  Gold Bug Problem: –  In order to solve the problem, we analyze the frequencies of pa]erns in the text wri]en in English Mo,f Finding and The Gold Bug Problem: Differences Mo0f Finding is harder than Gold Bug problem: –  We don’t have the complete dic,onary of mo,fs. –  The “gene,c” language does not have a standard “grammar”. –  Only a small frac,on of nucleo,de sequences encode for mo,fs; the size of data is enormous. The Mo,f Finding Problem •  Given a random sample of DNA sequences: The Mo,f Finding Problem (cont’d) •  The pa]erns revealed with no muta,ons: cctgatagacgctatctggctatccacgtacgtaggtcctctgtgcgaatctatgcgtttccaaccat cctgatagacgctatctggctatccacgtacgtaggtcctctgtgcgaatctatgcgtttccaaccat agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc aaacgtacgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc aaacgtacgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtacgtc ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtacgtc •  Find the pa]ern that is implanted in each of the individual sequences, namely, the mo,f. ! acgtacgt! Consensus String 6 9/2/13 The Mo,f Finding Problem (cont’d) •  The pa]erns with 2 point muta,ons: The Mo,f Finding Problem (cont’d) •  The pa]erns with 2 point muta,ons: cctgatagacgctatctggctat...
View Full Document

Ask a homework question - tutors are online