Calcula2ng the overlap for each pair of reads would

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: nd Illumina data –  LOCAS: Resequencing genomes. –  HapAssembler: for sequencing highly polymorphic genomes Problems! Unfortunately, overlap ­layout ­consensus approach will not work for NGS data or significantly large genomes: – There is too much data. Calcula2ng the overlap for each pair of reads would take way to much 2me. – There has to be a new method for fragment assembly. De Bruijn Graph Approach to Assembly De Bruijn Graph for Assembly •  Introduced in 1989. Pevzner. J Biomol Struct Dyn (1989) 7:63—73. Iduly & Waterman. J. Comput Biol (1995) 2:291—306. •  Adapted for next genera2on sequencing data. Euler ­SR: Chaisson & Pevzner. Genome Res. (2008) 18:324—30. Velvet: Zerbino & Birney. Genome Res. (2008) 18:821—29. ALLPATHS: Butler et al. Genome Res. (2008) 18(5):810—20. ABySS: Simpson et al. Genome Res (2009) 19:1117—1123. De Bruijn Graph Construc2on I.  Choose a value of !. II.  For each ! ­mer that exists in any sequence create an edge with one vertex labeled as the prefix and one vertex labeled as the suffix. III.  Glue all ver2ces that have the same label. (Pevzner, Tang & Tesler, 2004) De Bruijn Graph Construc2on GTCTATTCGCTAATTCACTA ATTC ATTCG ATTC ATTCA TTCG TTCA (Pevzner, Tang & Tesler, 2004) De Bruijn Graph Construc2on GTCTATTCGCTAATTCACTA ATTC ATTCG ATTC ATTCA TTCG TTCA (Pevzner, Tang & Tesler, 2004) De Bruijn Graph Construc2on GTCTATTCGCTAATTCACTA TTCG ATTCG ATTC ATTCA TTCA (Pevzner, Tang & Tesler, 2004) Challenges in Fragment Assembly •  Repeats in the genome. ACCAGTTGACTGGGATCCTTTTTAAAGACTGGGATTTTAACGCG CAGTTGACTG TGGGATCC TGGGATTT •  Sequencing errors, which vary by plamorm. TGGGAATT TGGGACTT Subs2tu2on TGGGA--T Dele2on TGGGAACTTATT Inser2on •  Size of the data, e.g. 1.5 billion reads. De Bruijn G...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern