Calcula2ng the overlap for each pair of reads would

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: nd Illumina data –  LOCAS: Resequencing genomes. –  HapAssembler: for sequencing highly polymorphic genomes Problems! Unfortunately, overlap ­layout ­consensus approach will not work for NGS data or significantly large genomes: – There is too much data. Calcula2ng the overlap for each pair of reads would take way to much 2me. – There has to be a new method for fragment assembly. De Bruijn Graph Approach to Assembly De Bruijn Graph for Assembly •  Introduced in 1989. Pevzner. J Biomol Struct Dyn (1989) 7:63—73. Iduly & Waterman. J. Comput Biol (1995) 2:291—306. •  Adapted for next genera2on sequencing data. Euler ­SR: Chaisson & Pevzner. Genome Res. (2008) 18:324—30. Velvet: Zerbino & Birney. Genome Res. (2008) 18:821—29. ALLPATHS: Butler et al. Genome Res. (2008) 18(5):810—20. ABySS: Simpson et al. Genome Res (2009) 19:1117—1123. De Bruijn Graph Construc2on I.  Choose a value of !. II.  For each ! ­mer that exists in any sequence create an edge with one vertex labeled as the prefix and one vertex labeled as the suffix. III.  Glue all ver2ces that have the same label. (Pevzner, Tang & Tesler, 2004) De Bruijn Graph Construc2on GTCTATTCGCTAATTCACTA ATTC ATTCG ATTC ATTCA TTCG TTCA (Pevzner, Tang & Tesler, 2004) De Bruijn Graph Construc2on GTCTATTCGCTAATTCACTA ATTC ATTCG ATTC ATTCA TTCG TTCA (Pevzner, Tang & Tesler, 2004) De Bruijn Graph Construc2on GTCTATTCGCTAATTCACTA TTCG ATTCG ATTC ATTCA TTCA (Pevzner, Tang & Tesler, 2004) Challenges in Fragment Assembly •  Repeats in the genome. ACCAGTTGACTGGGATCCTTTTTAAAGACTGGGATTTTAACGCG CAGTTGACTG TGGGATCC TGGGATTT •  Sequencing errors, which vary by plamorm. TGGGAATT TGGGACTT Subs2tu2on TGGGA--T Dele2on TGGGAACTTATT Inser2on •  Size of the data, e.g. 1.5 billion reads. De Bruijn G...
View Full Document

Ask a homework question - tutors are online