contigs 12 how do we use the reference the reads from

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Prepara*on Fragments Sequencing Reads Assembly ACGTAGAATACGTAGAA ACGTAGAATCGACCATG GGGACGTAGAATACGAC ACGTAGAATACGTAGAAACAGATTAGAGAG… Contigs 11 Sample Prepara*on Fragments Sequencing Reads Assembly ACGTAGAATACGTAGAA ACGTAGAATCGACCATG GGGACGTAGAATACGAC BUT WE DON’T HAVE TO BEGIN ACGTAGAATACGTAGAAACAGATTAGAGAG… FROM SCRATCH!!! Contigs 12 How do we use the reference? •  The reads from the individual will be very similar but not iden1cal to the reference genome. •  Ideally, we would like to use the informa1on from the reference! Otherwise, we are throwing up valuable informa1on. •  Hence, the first step is to find where in the genome the sequences are similar to. Sequence Alignment •  Before we can make compara1ve statements about two sequences, we have to produce a pairwise sequence alignment •  What is the op1mal alignment between two sequences? •  Match/mismatch? Gaps/extensions? Is a...
View Full Document

This note was uploaded on 02/10/2014 for the course CS 680 taught by Professor Staff during the Fall '08 term at Colorado State.

Ask a homework question - tutors are online