Mapping quality phred score iden1cal to the quality

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: sec1on” Example Headers: @HD @SQ @SQ @SQ @RG VN:1.0 SO:coordinate SN:1 LN:249250621 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:1b22b98cdeb4a9304cb5d48026a85128 SN:2 LN:243199373 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:a0d9851da00400dec1098a9255ac712e SN:3 LN:198022430 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:fdfd811849cc2fadebc929bb925902e5 ID:UM0098:1 PL:ILLUMINA PU:HWUSI-EAS1707-615LHAAXX-L001 LB:80 DT:2010-05-05T20:00:00-0400 SM:SD37743 Example Alignments: 1:497:R:-272+13M17D24M 113 1 497 CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG SM:i:37 AM:i:0 X0:i:1 X1:i:0 19:20389:F:275+18M2D19M 99 1 17644 TATGACTGCTAATAATACCTACACATGTTAGAACCAT XT:A:R NM:i:0 SM:i:0 AM:i:0 MD:Z:37 19:20389:F:275+18M2D19M 147 1 17919 GTAGTACCAACTGTAAGTCCTTATCTTCATACTTTGT SM:i:0 AM:i:0 X0:i:4 X1:i:0 9:21597+10M2I25M:R:-209 83 1 21678 CACCACATCACATATACCAAGCCTGGCTGTGTCTTCT SM:i:0 AM:i:0 X0:i:5 X1:i:0 37 37M 15 0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>> XM:i:0 XO:i:0 XG:i:0 0 37M = >>>>>>>>>>>>>>>>>>>><<>>><<>>4::>>:<9 X0:i:4 X1:i:0 XM:i:0 100338662 0 XT:A:U NM:i:0 MD:Z:37 17919 314 RG:Z:UM0098:1 XO:i:0 XG:i:0 0 18M2D19M = ;44999;499<8<8<<<8<<><<<<><7<;<<<>><< XM:i:0 XO:i:1 XG:i:2 0 8M2I27M = <;9<<5>&l...
View Full Document

This note was uploaded on 02/10/2014 for the course CS 680 taught by Professor Staff during the Fall '08 term at Colorado State.

Ask a homework question - tutors are online