lecture2 - Sequence Alignment Mo1va1on and Algorithms...

Info iconThis preview shows pages 1–14. Sign up to view the full content.

View Full Document Right Arrow Icon
Sequence’Alignment:’Mo1va1on’ and’Algorithms’ Lecture’2:’August’23,’20±2’
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Mo1va1on’and’Introduc1on
Background image of page 2
Importance’of’Sequence’Alignment For’DNA,’RNA’and’amino’acid’sequences,’high sequence’similarity’usually’implies’signi±cant’ func1onal’or’structural’similarity.’ imply’structure’from’the’sequence’similarity’ suggest’gene’func1on’ Frequently,’we’aren²t’interested’in’exact’ matches’of’the’sequences’but’approximate’ matches.’
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
In-exact’Alignment Where’is’GATTACA’approximately’in’the’human genome?’And’how’do’we’efficiently’fnd’them?’ It’depends’on:’ (a)’The’defni1on’oF’“approximately”’ Hamming’Distance,’Edit’distance,’or’Sequence’ Similarity’ (b)’Efficiency’depends’on’the’data’characteris1cs’ and’goals’
Background image of page 4
In’this’lecture… Sequence’alignment’and’alignment’soZware’ are’used’all’over’bioinforma1cs’for’diFerent’ purposes.’ Your’results’will’depend’highly’on’your’choice’ of’alignment’soZware.’ The’goal’of’this’lecture’is’to’understand’ sequence’alignment,’mo1vate’it’in’the’ context’of’assembly,’and’seeing’what’ soZware’is’out’there.’
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
In’this’lecture… Sequence’alignment’and’alignment’soZware’ are’used’all’over’bioinforma1cs’for’diFerent’ purposes.’ Your’results’will’depend’highly’on’your’choice’ of’alignment’soZware.’ The’goal’of’this’lecture’is’to’understand’ sequence’alignment,’ mo1vate’it’in’the’ context’of’assembly ,’and’seeing’what’ soZware’is’out’there.’
Background image of page 6
What’is’a’reference’genome? A’ reference genome ’is’a’representa1ve’ example’of’a’species±’set’of’genes.’ As’they’are’oZen’assembled’from’the’ sequencing’of’DNA’from’a’number’of’donors,’ reference’genomes’do’not’accurately’ represent’the’set’of’genes’of’any’individual.’ BUT’the’reference’is’very,’very,’VERY’similar’in many’loca1ons’to’the’individual.’
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Sample’Prepara*on 8
Background image of page 8
Sample’Prepara*on Fragments 9
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Sample’Prepara*on Sequencing ACGTAGAATCGACCATG GGGACGTAGAATACGAC ACGTAGAATACGTAGAA Reads Fragments Next Generation Sequencing (NGS) 10
Background image of page 10
Sample’Prepara*on Sequencing Assembly ACGTAGAATACGTAGAAACAGATTAGAGAG… Contigs Fragments Reads ACGTAGAATCGACCATG GGGACGTAGAATACGAC ACGTAGAATACGTAGAA 11
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Sample’Prepara*on Sequencing Assembly ACGTAGAATACGTAGAAACAGATTAGAGAG… Contigs Fragments Reads ACGTAGAATCGACCATG GGGACGTAGAATACGAC ACGTAGAATACGTAGAA 12 BUT WE DON’T HAVE TO BEGIN FROM SCRATCH!!!
Background image of page 12
How’do’we’use’the’reference?
Background image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 14
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 54

lecture2 - Sequence Alignment Mo1va1on and Algorithms...

This preview shows document pages 1 - 14. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online