lecture3 - Sequence Alignment Con0nued Lecture 3 August 28...

Info iconThis preview shows pages 1–12. Sign up to view the full content.

View Full Document Right Arrow Icon
Sequence’Alignment’Con0nued’ Lecture’3:’August’28,’2±12’
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Review’from’Last’Lecture:’ Exis0ng’Tools
Background image of page 2
Diferent’Sequence’Alignment Database’Search:’ BLAST ,’FASTA,’HMMER’ Mul0ple’Sequence’Alignment:’ ClustalW,’FSA’ Genomic’Analysis:’ BLAT’ Short’Read’Sequence’Alignment:’ BWA ,’ Bow)e ,’drFAST,’GSNAP,’SHRiMP,’SOAP,’ MAQ’
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Short’Read’Alignment’SW Bow)e :’memory-efficient’short’read’aligner.’It’ aligns’short’DNA’sequences’(reads)’to’the’human’ genome’at’a’rate’of’over’25’million’35-bp’reads’per’ hours’ Burrows-Wheeler Aligner (BWA± :’an’aligner’that’ implements’two’algorithms:’ bwa-short ’and’ BWA- SW .’The’former’works’for’query’sequences’shorter’ than’200’ bp’and’the’la\er’for’longer’sequences’up’ to’around’100’ kbp.’
Background image of page 4
Sequence’Alignment/Map’Format Input:’query’and’ reference’sequences.’ Alignment’So9ware’ SAM’File’ Resequencing’ RNA’ Seq’ SNPs’
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Understanding’the’Input’and’ Output’of’BWA
Background image of page 6
Sequence’Alignment/Map’Format Sequence’Reads’+’ Reference’Sequence’ Alignment’So9ware’ SAM’File’ Resequencing’ RNA’ Seq’ SNPs’ Reads: Illumina or 454 reads. Reference: whole genome, contig, chromosome. BWA , Bowtie, mrsFAST, GSNAP. Most of the analysis happens when considering the SAM files.
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
SAM’format “A’tab-delimited’text’format’consis0ng’of’a’header’sec0on,’ which’is’op0onal,’and’an’alignment’sec0on”’ @HD VN:1.0 SO:coordinate @SQ SN:1 LN:249250621 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:1b22b98cdeb4a9304cb5d48026a85128 @SQ SN:2 LN:243199373 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:a0d9851da00400dec1098a9255ac712e @SQ SN:3 LN:198022430 AS:NCBI37 UR:file:/data/local/ref/GATK/human_g1k_v37.fasta M5:fdfd811849cc2fadebc929bb925902e5 @RG ID:UM0098:1 PL:ILLUMINA PU:HWUSI-EAS1707-615LHAAXX-L001 LB:80 DT:2010-05-05T20:00:00-0400 SM:SD37 Example Headers: 1:497:R:-272+13M17D24M 113 1 497 37 37M 15 100338662 0 CGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAG 0;==-==9;>>>>>=>>>>>>>>>>>=>>>>>>>>>> XT:A:U NM:i:0 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37 19:20389:F:275+18M2D19M 99 1 17644 0 37M = 17919 314 TATGACTGCTAATAATACCTACACATGTTAGAACCAT >>>>>>>>>>>>>>>>>>>><<>>><<>>4::>>:<9 RG:Z:UM0098:1 XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:37 19:20389:F:275+18M2D19M 147 1 17919 0 18M2D19M = 17644 -314 GTAGTACCAACTGTAAGTCCTTATCTTCATACTTTGT ;44999;499<8<8<<<8<<><<<<><7<;<<<>><< XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:18^CA19 9:21597+10M2I25M:R:-209 83 1 21678 0 8M2I27M = 21469 -244 CACCACATCACATATACCAAGCCTGGCTGTGTCTTCT <;9<<5><<<<><<<>><<><>><9>><>>>9>>><> XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:5 X1:i:0 XM:i:0 XO:i:1 XG:i:2 MD:Z:35 Example Alignments:
Background image of page 8
The’Alignment’Column
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
The’Alignment’Column
Background image of page 10
Harves0ng’Informa0on’from’SAM Query’name,’QNAME’(SAM)/ read_name’(BAM).’
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 12
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 38

lecture3 - Sequence Alignment Con0nued Lecture 3 August 28...

This preview shows document pages 1 - 12. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online