1 cytochrome b elephas maximus maximus

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: t posi@on. –  Duplica4on. A copy of a piece of DNA is inserted into the genome Muta@ons and Selec@on •  While muta@ons can be detrimental to the affected individual, they can also in rare cases be beneficial; more frequently, neutral. •  Ofen muta@ons have no or a negligible impact on survival and reproduc@on. •  Thereby muta@ons can increase the gene4c diversity of a popula@on, that is, the number of present polymorphisms. •  In combina@on with selec@on, this allow a species to adapt to changing environmental condi@ons and to survive in the long term. Raw Sequence Data •  4 bases: A, C, G, T + other (i.e. N = any, R = G or A (purine), Y = T or (pyrimidine)) –  kb (= kbp) = kilo base pairs = 1,000 bp –  Mb = mega base pairs = 1,000,000 bp –  Gb = giga base pairs = 1,000,000,000 bp. •  Size: –  E. Coli 4.6Mbp (4,600,000) –  Fish 130 Gbp (130,000,000,000) –  Paris japonica (Plant) 150 Gbp –  Human 3.2Gbp Fasta File •  A sequence in FASTA format begins with a single ­line descrip@on, followed by lines of sequence data (file extension is .fa). •  It is recommended that all lines of text be shorter than 80 characters in length. Fastq File •  Typically contain 4 lines: –  Line 1 begins with a '@' character and is followed by a sequence iden@fier and an op#onal descrip@on. –  Line 2 is the sequence. –  Line 3 is the delimiter ‘+’, with an op@onal descrip@on. –  Line 4 is the quality score. –  file extension is .fq @SEQ_ID! GATTTGGGGTTCAAAGCTTCAAAGCTTCAAAGC! +! !''*((((***+))%%%++++++++!!!++***! Proteins: Primary Structure •  Pep@de sequence: –  Sequence of amino acids = sequences from a 20 leger alphabet (i.e. ACDEFGHIKLMNPQRSTVWY)! –  Average protein has ~300 amino acids –  Typically stored as fasta files...
View Full Document

Ask a homework question - tutors are online