1 cytochrome b elephas maximus maximus

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: t [email protected] –  Duplica4on. A copy of a piece of DNA is inserted into the genome [email protected] and [email protected] •  While [email protected] can be detrimental to the affected individual, they can also in rare cases be beneficial; more frequently, neutral. •  Ofen [email protected] have no or a negligible impact on survival and [email protected] •  Thereby [email protected] can increase the gene4c diversity of a [email protected], that is, the number of present polymorphisms. •  In [email protected] with [email protected], this allow a species to adapt to changing environmental [email protected] and to survive in the long term. Raw Sequence Data •  4 bases: A, C, G, T + other (i.e. N = any, R = G or A (purine), Y = T or (pyrimidine)) –  kb (= kbp) = kilo base pairs = 1,000 bp –  Mb = mega base pairs = 1,000,000 bp –  Gb = giga base pairs = 1,000,000,000 bp. •  Size: –  E. Coli 4.6Mbp (4,600,000) –  Fish 130 Gbp (130,000,000,000) –  Paris japonica (Plant) 150 Gbp –  Human 3.2Gbp Fasta File •  A sequence in FASTA format begins with a single ­line [email protected], followed by lines of sequence data (file extension is .fa). •  It is recommended that all lines of text be shorter than 80 characters in length. Fastq File •  Typically contain 4 lines: –  Line 1 begins with a '@' character and is followed by a sequence iden@fier and an op#onal [email protected] –  Line 2 is the sequence. –  Line 3 is the delimiter ‘+’, with an [email protected] [email protected] –  Line 4 is the quality score. –  file extension is .fq @SEQ_ID! GATTTGGGGTTCAAAGCTTCAAAGCTTCAAAGC! +! !''*((((***+))%%%++++++++!!!++***! Proteins: Primary Structure •  [email protected] sequence: –  Sequence of amino acids = sequences from a 20 leger alphabet (i.e. ACDEFGHIKLMNPQRSTVWY)! –  Average protein has ~300 amino acids –  Typically stored as fasta files...
View Full Document

This note was uploaded on 02/10/2014 for the course CS 680 taught by Professor Staff during the Fall '08 term at Colorado State.

Ask a homework question - tutors are online