Lecture+5+-+Genetics+Outline

15 mrna there is one unique mrna strand for each

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 0s 60S Protein + rRNA 40S Eukaryote 80s Fig 7.15 mRNA There is one unique mRNA strand for each unique protein A cell can make multiple copies of the same protein from one mRNA mRNA 5’ template auucaaaggaggauaacaaugccucacccauaggacauuauagucuuaugucuau 3’ tRNA Each amino acid matches a unique tRNA with a specific nucleotide sequence Q <-- Amino Acids MATCH! <-- HAS to match Q and UAC 3’ U A C 5’ tRNA anticodon Fig 7.14 Translation initiation Activated tRNAs 30S 5’ mRNA template 3’ 50S Fig 7.17 Translation initiation Activated tRNAs mRNA 5’ template 30S 3’ 50S 1. Ribosome assembles on the mRNA at specific spot called the (SHINE-DALGARNO SEQUENCE) ____________________________________ Translation initiation Activated tRNAs line up anticon with their amino acids 5’ mRNA template 3’ 2. Activated tRNAs arrive at the ribosome Translation elongation Activated tRNAs peptide bond links amino acids 5’ mRNA template 3’ 3. A peptide bond is formed between the two amino acids Fig 7.18 Translat...
View Full Document

This note was uploaded on 02/10/2014 for the course CHEM 341 taught by Professor Skagg during the Spring '11 term at Indiana.

Ask a homework question - tutors are online