{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

09BIS1012013TransciptLect9-1

Lrodriguez 2013

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: esent In nucleotides that appear that in the promoter sequence, less than (lower case) and more than (upper case) 50% of the time. Subscript numbers represent percentages of occurrence while numbers above the sequence refer to conserved regions identified by Pribnow. Mutation analysis has shown that these conserved regions are required for the promoter function. Upward arrows in the second row refer to enhanced transcription, down arrows refer to mutations that decrease transcription. Mutations that change the sequence toward consensus increase transcription. transcription. -35 -10 +1 ctT82T84G78A65C54a45-----15 to 18 bp--------T80A95t45A60a50T96--4 to 9 bp---cat-(iq) T C T (UV5) AA C T C GT +1 t c T T G A C a -------(15 to 18 bp) --------T A t A a T -----------c a t-----A A T AG T C C A BIS101­001, Spring 2013—Genes and Gene Expression, R.L. Rodriguez ©2013 BIS101­001, Spring 2013—Genes and Gene Expression, R.L. Rodriguez 21 Example of 3 Common Bacterial Promoters ­35 ­10 +1 5'­CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCAC 3'­GGTCCGAAATGTGAAATACGAAGGCCGAGCATATTACACACCTTAACACTCGCCTATTGTTAAAGTG SD site Met ACAGGAAACAGAATTCTATG­3' TGTCCTTTGTCTTAAGATAC­5’ E. coli lac UV5 ­35 ­10 +1 5'­GAATTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCT 3'­CTTAAGAGTACAAACTGTCGAATAGTAGCTATTCGAAATTACGCCATCAAATAGTGTCAATTTAACGA SD site Met AACGCAGTCAGGCACCGTGTATG­3' TTGCGTCAGTCCGTGGCACATAC­5’ pBR322 Resistance ­35 ­10 +1 5'­TATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCT 3'­ATAAACAAATAAAAAGATTTATGTAAGTTTATACATAGGCGAGTACTCTGTTATTGGGACTATTTACGA SD site Met TCAATAATATTGAAAAAGAAGAGTATG­3' AGTTATTATAACTTTTTCTTCTCATAC­5' pBR322/pUC19 Ampicillin Resistance B...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern