09BIS1012013TransciptLect9-1

Lrodriguez 2013

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: esent In nucleotides that appear that in the promoter sequence, less than (lower case) and more than (upper case) 50% of the time. Subscript numbers represent percentages of occurrence while numbers above the sequence refer to conserved regions identified by Pribnow. Mutation analysis has shown that these conserved regions are required for the promoter function. Upward arrows in the second row refer to enhanced transcription, down arrows refer to mutations that decrease transcription. Mutations that change the sequence toward consensus increase transcription. transcription. -35 -10 +1 ctT82T84G78A65C54a45-----15 to 18 bp--------T80A95t45A60a50T96--4 to 9 bp---cat-(iq) T C T (UV5) AA C T C GT +1 t c T T G A C a -------(15 to 18 bp) --------T A t A a T -----------c a t-----A A T AG T C C A BIS101­001, Spring 2013—Genes and Gene Expression, R.L. Rodriguez ©2013 BIS101­001, Spring 2013—Genes and Gene Expression, R.L. Rodriguez 21 Example of 3 Common Bacterial Promoters ­35 ­10 +1 5'­CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCAC 3'­GGTCCGAAATGTGAAATACGAAGGCCGAGCATATTACACACCTTAACACTCGCCTATTGTTAAAGTG SD site Met ACAGGAAACAGAATTCTATG­3' TGTCCTTTGTCTTAAGATAC­5’ E. coli lac UV5 ­35 ­10 +1 5'­GAATTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCT 3'­CTTAAGAGTACAAACTGTCGAATAGTAGCTATTCGAAATTACGCCATCAAATAGTGTCAATTTAACGA SD site Met AACGCAGTCAGGCACCGTGTATG­3' TTGCGTCAGTCCGTGGCACATAC­5’ pBR322 Resistance ­35 ­10 +1 5'­TATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCT 3'­ATAAACAAATAAAAAGATTTATGTAAGTTTATACATAGGCGAGTACTCTGTTATTGGGACTATTTACGA SD site Met TCAATAATATTGAAAAAGAAGAGTATG­3' AGTTATTATAACTTTTTCTTCTCATAC­5' pBR322/pUC19 Ampicillin Resistance B...
View Full Document

This note was uploaded on 02/12/2014 for the course BIS 101 taught by Professor Simonchan during the Spring '08 term at UC Davis.

Ask a homework question - tutors are online