EX8 BioinformaticsProtocolanddatasheet_CV.docx - Name...

This preview shows page 1 - 3 out of 5 pages.

Name: Elizabeth Koegel Section: 111-561 Bioinformatics Lab Lab Activity 1: Sequence Taxonomy 1. Approximately what proportion of the presently described species of life on Earth
2.
3. Pick an extinct species to investigate.
b.
c. 2
d.
e. How many nucleotides long is the sequence? (you can find this in the first
f. What is the citation for the paper reporting the sequence?
Lab Activity 2: Sequence Searching (in class) 4. My sequence number is (from TA):
1
Name: Elizabeth Koegel Section: 111-561 CTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACT GGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATT GCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCC TTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGTGTTGTGGTTAATAACC GCAGCAATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGC

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture