
It will be in gates 159 tomorrow from 10001130 chris

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: plantains: hIp://laylita.com/recetas/2008/02/28/platanos ­maduros ­fritos/ Dan Jurafsky Informa<on Extrac<on Event: Curriculum mtg Date: Jan-16-2012 Subject: curriculum mee<ng Start: 10:00am Date: January 15, 2012 End: 11:30am Where: Gates 159 To: Dan Jurafsky Hi Dan, we’ve now scheduled the curriculum mee6ng. It will be in Gates 159 tomorrow from 10:00 ­11:30.  ­Chris Create new Calendar entry Dan Jurafsky Computa<onal Biology: Finding Genes 5 Intron 1 Intron 2 Exon 3 Exon 1 Exon 2 Start codon ATG Splice sites 3 Stop codon TAG/TGA/TAA Pictures from Serafim Batzoglou Dan Jurafsky Computa<onal Biology: Comparing Sequences AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--| | | | | | | | | | | | | x | | | | | | | | | | | TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Sequence comparison is key to •  Finding genes •  Determining function •  Uncovering the evolutionary processes Slide stuff from Serafim Batzoglou Dan Jurafsky Ambiguity •  Resolving ambiguity is a crucial goal throughout string and language processing Dan Jurafsky Ambiguity •  Find at least 5 meanings of this sentence: •  I made her duck Dan Jurafsky Ambiguity •  Find at least 5 meanings of this sentenc...
View Full Document

This document was uploaded on 02/14/2014.

Ask a homework question - tutors are online