I wanted to get across the idea that this was dynamic

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: •  Biology: certain kinds of dele'ons or inser'ons are more likely than others Dan Jurafsky Confusion matrix for spelling errors Dan Jurafsky Dan Jurafsky Weighted Min Edit Distance •  Ini'aliza'on: D(0,0) = 0! D(i,0) = D(i-1,0) + del[x(i)]; D(0,j) = D(0,j-1) + ins[y(j)]; 1 < i ≤ N! 1 < j ≤ M •  Recurrence Rela'on: D(i,j)= min D(i-1,j) + del[x(i)]! D(i,j-1) + ins[y(j)]! D(i-1,j-1) + sub[x(i),y(j)]! •  Termina'on: D(N,M) is distance ! ! Dan Jurafsky Where did the name, dynamic programming, come from? …The 1950s were not good years for mathematical research. [the] Secretary of Defense …had a pathological fear and hatred of the word, research… I decided therefore to use the word, “programming”. I wanted to get across the idea that this was dynamic, this was multistage… I thought, let’s … take a word that has an absolutely precise meaning, namely dynamic… it’s impossible to use the word, dynamic, in a pejorative sense. Try thinking of some combination that will possibly give it a pejorative meaning. It’s impossible. Thus, I thought dynamic programming was a good name. It was something not even a Congressman could object to.” Richard Bellman, “Eye of the Hurricane: an autobiography” 1984. Minimum Edit Distance Weighted Minimum Edit Distance Minimum Edit Distance Minimum Edit Distance in Computa'onal Biology Dan Jurafsky Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Dan Jurafsky Why sequence alignment? •  Comparing genes or regions from different species •  to find important regions •  determine func'on •  uncover evolu'onary forces •  Assembling fragments to sequence DNA •  Compare individuals to looking for muta'ons Dan Jurafsky Alignments in two fields •  In Natural Language Processing •  We generally talk about distance (minimized) •  And weights •  In Computa'onal Biology •  We generally talk about similarity (maximized) •  And score...
View Full Document

This document was uploaded on 02/14/2014.

Ask a homework question - tutors are online