
MCDB1A_Final_Exam_Fall2006 - Name_ TA_ MCDB 1A FINAL...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
Name______________________ TA________________________ MCDB 1A FINAL EXAMINATION DECEMBER 16, 2006 Scantron instructions: 1. Use a #2 pencil to complete the form. 2. Write your name and fill in the appropriate bubbles. 3. Write your perm. number in the ID number box and fill in the bubbles . 4. Write the color of your test in the space underneath the I.D. number box. 5. Fill in the entire rectangle of the best answer. Part I. Biochemistry: Dr. Feinstein Questions 1-16 (3 pts each) 48 points Part II. Cell Biology: Dr. Wilson Questions 17-33 (3 pts each) 51 points Part III. Genetics Dr. Christoffersen Questions 34–83 (3pts each) 150 points Test Color 1 point 250 points __________________________________________________ Part I. Biochemistry Dr. Feinstein Questions 1 -16 (3 points each); 48 points total Choose the one answer that best completes the statement or answers the question. The GENETIC CODE and METOBOLIC PATHWAYS are at the end of the Exam. 1. If you started with 5 identical, double stranded DNA molecules and subjected them to 7 rounds of PCR amplification, how many copies of the DNA molecule would you have at the end of round 7? A. 12 B. 35 C. 320 D. 640 E. some other number 2. If human cells have 22% C in their DNA, how much A is present? A. 22% B. 28% C. 25% D. no way to know based on the given information 3. Imagine that the reaction A + B --> C + D has a delta G = -3 kcal/mole. What does this mean about the reaction? A. it will proceed to C+ D at a fast rate B. it will not proceed to C + D no matter how long you wait C. it will proceed to C + D at a slow rate D. it will proceed to C + D, but it is impossible to know at what rate it will proceed MCDB 1A Final Pink Version: 0 Page: 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
4. Is this the proper chemistry for peptide bond formation? A. yes B. no 5. Which strand of DNA in the replication fork drawn to the right is going to be the template for the "leading strand? A. strand #1 B. strand #2 C. both will be leading strands D. neither strand will be a leading strand E. more information is required to answer the question 6. Consider the following transcription bubble. If the sequence to be transcribed is to the right of the bubble, will the upper or lower strand of DNA serve as the template for RNA polymerase? A. upper B. lower C. insufficient information to answer the question MCDB 1A Final Pink Version: 0 Page: 2
Background image of page 2
7. The molecule drawn below is a precursor for which class of macromolecule? A. lipid B. polysaccharide C. protein D. nucleic acid 8. Consider the following mRNA: 5' ACAACUGGCUAGAUGUUUCAAAGGCAACCCUAAGUGUCAUGA How many amino acids would be in the encoded protein? A. 6 B. 7 C. 8 D. 9 E. some other number 9. What amino acid would be at position 2 for the mRNA in the previous question? A. phenylalanine
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/07/2008 for the course MCDB 1a taught by Professor Feinstein during the Spring '08 term at UCSB.

Page1 / 19

MCDB1A_Final_Exam_Fall2006 - Name_ TA_ MCDB 1A FINAL...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online