Lecture.14.Fall.2013

5 augcaauuggccaaauuugggccc 3 3

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: mentary to one strand of the DNA template DNA template 5’-ATGCAATTGGCCAAATTTGGGCCC-3’ 3’-TACGTTAACCGGTTTAAACCCGGG-5’ rna polym mRNA 5’-AUGCAAUUGGCCAAAUUUGGGCCC-3’ 3’-TACGTTAACCGGTTTAAACCCGGG-5’ Initiation: Promoters • How does RNA polymerase know where a gene begins? – $ subunit (with the two ! subunits) recognizes promoter sequences in the DNA – Promoters are located about 40 base pairs upstream (5’) of the transcription initiation site of a gene • The primary regulatory sequences for gene expression • Promoters control strength of gene expression through regulation of the efficiency of transcriptional initiation Consensus Promoter Sequences seq varies little, common BP found • Consensus sequence: The most commonly encountered bases at each position in a group of conserved sequences • Bacterial promoters have two consensus promoter sequences: – The Pribnow Box, or -10 sequence (10 bp upstream of the initiation site) (sequence TATAAT) l to r – The -35 sequence (TTGACA) – $ binds both of these sequences Consensus Promoter Sequences • Consensus promoter sequences are “cis-acting” factors • “cis” = in the same place • Only have effects if they’re on the same DNA molecule • The proteins that bind to these sequences ($, other DNA-binding proteins) are “trans-acting factors” • “trans” = in a different place • these are diffusible factors, can act on any DNA molecule can move around, ex enz Initiation: Unwinding • RNA polymerase unwinds the helix a small amount and begins to catalyze the production of the complementary mRNA molecule Elongation Not well understood RNA polymerase undergoes a conformational (shape) change Usually releases the $ factor These changes make it unable to bind the promoter sequence, and the polymerase escapes from the promoter Elongation begins Termination of Transcription part of gene itself • Intrinsic termination: • In bacteria, transcr...
View Full Document

Ask a homework question - tutors are online