New Perspectives on Melanoma_ The Role of PAX3

Overexpression of tpd52 associated with cellular

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: described [2]. Briefly, 5x104 cells/ cover slip were grown for 24 hours, as described above. Following fixation in 4% paraformaldehyde, and blocking with 10% NGS, cells were double‐stained with anti‐PAX3 (Invitrogen, 1/500) and anti‐MITF (Merck, 1/200) antibody overnight. Controls with primary antibodies withheld were immunonegative. 80 Chapter IV – Medic, Rizos and Ziman, 2011 Western blotting Total cellular proteins were extracted using RIPA lysis buffer containing protease inhibitors (Roche). Proteins (30–50 mg) were resolved on 12% SDS‐ polyacrylamide gels and transferred to Immobilon‐P membranes (Millipore). Western blots were probed with antibodies against PAX3 (DSHB) and β‐actin (Abcam), and proteins detected with ECL Western Blot Detection Kit (Amersham). ChIP Chromatin immunoprecipitation was performed using the EZ‐Magna ChIP A kit (Millipore) according to the manufacturer’s recommendations. Briefly, melanocyte and melanoma cells were fixed in 1% formaldehyde, harvested, lysed, and DNA was sheared using a Branson450 Sonifier. Immunoprecipitation (IP) was performed with 5µg of either anti‐PAX3 (from either DSHB or Invitrogen) or anti‐ IgG antibody (Millipore) as negative control. A 2% aliquot of sheared DNA prior to immunoprecipitation was used as input. All IPs were done in duplicate. Positive control promoters of Microphthalmia associated transcription factor (MITF) (‐ 332/+5) and Dopachrome tautomerase (DCT) (‐186/‐3), encompassing the confirmed PAX3 binding sites [64,65,187], were amplified with 5’‐ TCCTCCAAAGGGGCATTCTGCT and 5’‐TCCCGAGACACCACCGGAAA (MITF); and 5’‐ TGCCCTCCTGAAATAAAGCC and 5’‐AAGCCAAACACCGTGCTG (DCT). Negative control primers (Millipore) amplified a non‐related GAPDH promoter sequence. All PCRs were amplified using a Taq DNA Polymerase kit (Qiagen) for 40 cycles. qPCR analysis of the gene promoter Profiling of ChIP samples was done with custom designed ChampionChIP PCR array (Qiagen) containing 12 genomic sites of interest (Supplementary Table S1)....
View Full Document

Ask a homework question - tutors are online