{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

New Perspectives on Melanoma_ The Role of PAX3

Wefound that epidermal melanocytes resemble transit

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: tory properties to melanocytes PAX3 predisposes them to a more motile phenotype upon malignant transformation thus contributing to metastatic spread of melanoma cells. Future studies to evaluate PAX3 as a potential target for melanoma treatment are suggested. 90 Chapter IV – Medic, Rizos and Ziman, 2011 Acknowledgments The authors would like to thank Dr. Mark Brown and Dr. Rob White for thoughtful discussions. The Pax3 monoclonal antibody, developed by C.P. Ordahl, was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by the University of Iowa, Department of Biological Sciences, Iowa City, IA 52242. 91 Chapter IV – Medic, Rizos and Ziman, 2011 Supplementary data Table S1. Selected PAX3 target genes included in the custom promoter binding qPCR array. ChIP­qPCR Assay cat # Gene Binding site Biding position sequence HES1 (Hairy and enhancer of split 1) GPH1009779(+)04A SOX9 (SRY (sex determining region Y)‐box 9) GPH1005991(‐)01A 193857155 TTGGTCATGCCCCA 70117017 CTCGTCACCCAGCC NES (Nestin) GPH1015041(+)01A 156646502 CGCGCCACGCCTCG CCNA2 (Cyclin A2) GPH1023871(+)02A 1227743650 ATCTTCACGCTCTA TPD52 (Tumour protein D52) GPH1026252(+)01A NF­Kβ2 (Nuclear factor kappa β 2 (p100)) GPH1001851(‐)01A 81083671 CTCGCCGCGGTCCA 104154208 GCGAGGCGTGACGC BCL2L1 (BCL2 like protein 1) PTEN (Phosphatase and tensin homologue deleted from chromosome 10) TGFβ1 (Transforming growth factor‐beta isoform 1) MCAM (Melanoma cell adhesion molecule) CSPG4 (Chondroitin sulphate proteoglycan 4) GPH1022053(‐)01A 30311475 CGGAAGCGGGACGG GPH1001746(‐)02A 89622131 CTCGCCCCGCCCAC GPH1020707(‐)05A 41863841 ATGGGGTGGGACCA GPH1016778(+)05A 119183639 ACAGTCTGGGACGA GPH1018524(‐)05A 76009320 AGTGGCTGTGACCA GPH1021572(+)01A 136872816 TTGGAGTGTGACAG GPH1021572(+)01A 136873229 GGGAAGCGTGATGA CXCR4 (CXC chemokine receptor 4) Table S2. Primers used in RT‐qPCR analysis. Gene Forward primers Reverse primer GAPDH 5’‐TTCTTTTGCGTCGCCAGCCGAG‐3’ 5’‐GTGACCAGGCGCCCAATACGA‐3’ PAX3 5’‐AGCCGCATCCTGAGAAGTAA‐3...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern