New Perspectives on Melanoma_ The Role of PAX3

New Perspectives on Melanoma The Role of PAX3

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: tory properties to melanocytes PAX3 predisposes them to a more motile phenotype upon malignant transformation thus contributing to metastatic spread of melanoma cells. Future studies to evaluate PAX3 as a potential target for melanoma treatment are suggested. 90 Chapter IV – Medic, Rizos and Ziman, 2011 Acknowledgments The authors would like to thank Dr. Mark Brown and Dr. Rob White for thoughtful discussions. The Pax3 monoclonal antibody, developed by C.P. Ordahl, was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by the University of Iowa, Department of Biological Sciences, Iowa City, IA 52242. 91 Chapter IV – Medic, Rizos and Ziman, 2011 Supplementary data Table S1. Selected PAX3 target genes included in the custom promoter binding qPCR array. ChIP­qPCR Assay cat # Gene Binding site Biding position sequence HES1 (Hairy and enhancer of split 1) GPH1009779(+)04A SOX9 (SRY (sex determining region Y)‐box 9) GPH1005991(‐)01A 193857155 TTGGTCATGCCCCA 70117017 CTCGTCACCCAGCC NES (Nestin) GPH1015041(+)01A 156646502 CGCGCCACGCCTCG CCNA2 (Cyclin A2) GPH1023871(+)02A 1227743650 ATCTTCACGCTCTA TPD52 (Tumour protein D52) GPH1026252(+)01A NF­Kβ2 (Nuclear factor kappa β 2 (p100)) GPH1001851(‐)01A 81083671 CTCGCCGCGGTCCA 104154208 GCGAGGCGTGACGC BCL2L1 (BCL2 like protein 1) PTEN (Phosphatase and tensin homologue deleted from chromosome 10) TGFβ1 (Transforming growth factor‐beta isoform 1) MCAM (Melanoma cell adhesion molecule) CSPG4 (Chondroitin sulphate proteoglycan 4) GPH1022053(‐)01A 30311475 CGGAAGCGGGACGG GPH1001746(‐)02A 89622131 CTCGCCCCGCCCAC GPH1020707(‐)05A 41863841 ATGGGGTGGGACCA GPH1016778(+)05A 119183639 ACAGTCTGGGACGA GPH1018524(‐)05A 76009320 AGTGGCTGTGACCA GPH1021572(+)01A 136872816 TTGGAGTGTGACAG GPH1021572(+)01A 136873229 GGGAAGCGTGATGA CXCR4 (CXC chemokine receptor 4) Table S2. Primers used in RT‐qPCR analysis. Gene Forward primers Reverse primer GAPDH 5’‐TTCTTTTGCGTCGCCAGCCGAG‐3’ 5’‐GTGACCAGGCGCCCAATACGA‐3’ PAX3 5’‐AGCCGCATCCTGAGAAGTAA‐3...
View Full Document

This document was uploaded on 03/06/2014 for the course CHEMISTRY 12 at National University of Singapore.

Ask a homework question - tutors are online