E2 F12 answer key

E2 F12 answer key - Che 4342 Topics in Human Biochemistry...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Che 4342: Topics in Human Biochemistry EXAM 2 10/16/12 Name:_________________________ Choose the single best answer. Only your scantron will be graded. 1-30, 3.5 pts each 1. In general, how is the melting curve of duplex DNA in an aqueous solution affected by addition of a small amount of ethanol? a. the T m would increase b. the T m would decrease c. the T m would stay approximately the same d. it would depend on the G-C content of the DNA e. further information is required to answer this question 2. How does the D-ribose pucker affect DNA structure? a. the ribose pucker dictates the relative orientation of the phosphate backbone group to the carbohydrate in each residue b. in B DNA it is C2 / - exo c. in B DNA it is C3 / - endo d. in A DNA it is C3 / - exo e. in A DNA it is C5 / - exo 3. In addition to the standard base-paired helical structures, DNA can form specialized structures. What type of structure often occurs at sequences with inverted repeats such as TCAAGTCCACGGTGGACTTGC? a. A-DNA b. negatively supercoiled DNA c. X-shaped hairpin structure called a cruciform d. a G-quartet e. left-handed helix (Z-DNA) 4. Which of the following statements about nucleosomes is NOT correct? a. they contain proteins with high levels of Asn and Gln residues b. they constitute a major packing structure for DNA, approximately 80 Å in diameter c. the nucleosome core particle consist of approximately 146 bp of DNA wrapped around histone octomers: (H2A) 2 , (H2B) 2 , (H3) 2 , (H4) 2 d. the nucleosome introduces negative superhelicity into mammalian DNA e. nucleosome particles must be disassembled and reassembled during replication and transcription
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
2 5. Which of the following statements about topoisomerases is NOT correct? a. type I –topoisomerases catalyze the relaxation of supercoiled DNA by changing the linking number in increments of one b. the prokaryotic type II topoisomerase, DNA gyrase, is inhibited by: c. type II topoisomerases make transient double stranded breaks in DNA d. transient, covalently modified Tyr residues are formed by both type I and II topoisomerases e. type I topoisomerases require the hydrolysis of ATP to complete a reaction cycle, but type II enzymes do not 6. Examine the Figure of the eukaryotic replisome below. Which of the following statements about proteins that participate in mammalian DNA replication is NOT correct? a. A designates one subunit of the ATP-dependent helicase, MCM b. B designates DNA pol ε , a classical B family enzyme with proofreading 3 / –>5 / exonuclease activity c. C designates RFC, replication factor C which is the ATP-dependent clamp loader d. D designates DNA pol α e. E designates RPA, replication protein A which binds to single stranded DNA and prevents it from re-annealing 7. Which of the following statements about DNA replication in eukaryotes is NOT correct?
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 15

E2 F12 answer key - Che 4342 Topics in Human Biochemistry...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online