1450 ccgggaaaacgattagtacaagtatggagaatagaaggagggtgt

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: -------+---------+---------1550 a: ProPheCysEndSerCysSerTyrLeuLeuSerSerSerHisSerSerTrpGGGGTGGTCACGTCCGACGGATAGTCTTTCACCACCGACCACACCGATTA b: ProPheAlaAsnHisValHisThrSerTyrLeuProProThrAlaPro 130 AlaLeuLeuLeuIleMetPheIleProLeuIlePheLeuProGlnLEULeu ac: : ProHisGlnCysArgLeuProIleArgLysTrpTrpLeuValTrpLeuMet b: ProThrSerAlaGlyCysLeuSerGluSerGlyGlyTrpCysGlyEndCysc: ProProValGlnAlaAlaTYRGlnLysValValAlaGlyValAlaAsn - APAIB page 254 The stop codon GGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA 1451 ---------+---------+---------+---------+---------1500 GCCCGTTGCACGACCAGACACACGACCGGGTAGTGAAACCGTTTCTTAAGT CCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCT 110 120 1551 ---------+---------+---------+---------+---------1600 a: AlaThrCysTrpSerValCysTrpProIleThrLeuAlaLysAsnSer CGGGACCGGGTGTTCATAGTGATTCGAGCGAAAGAACGACAGGTTAAAGA b: 1GlyGlnArgAlaGlyLeuCysAlaGlyProSerLeuTrpGlnArgIleHis 40 146 c: GlyAsnValLEUValCysValLeuAlaHisHisPheGlyLYSGluPheThra: ProTrpProThrSerIleThrLysLeuAlaPheLeuLeuSerAsnPheTyrb: ProGlyProGlnValSerLeuSerSerLeuSerCysCysProIleSer c: ALALeuAlaHisLysTyrHISEndAlaArgPheLeuAlaValGlnPheLeu - ATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATT 1601 ---------+---------+---------+---------+---------1650 253 iClicker Question 1: Which of these is the longest part of the beta- globin gene? A. Exon 1 B. Intron 1 C. Exon 2 D. Intron 2 E. Exon 3 TGTAAACGAAGACTGTGTTGACACAAGTGATCGTTGGAGTTTGTCTGTGG a: iClicker Question 2: IleCysPheEndHisAsnCysValHisEndGlnProGlnThrAspThr b: ThrPheAlaSerA...
View Full Document

This note was uploaded on 03/28/2014 for the course BIO 111 taught by Professor White during the Fall '11 term at University of Massachusetts Boston.

Ask a homework question - tutors are online