250 lysvalasnvalaspgluvalglyglyglualaleuglyargleu

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: er GTTCCACTTGCACCTACTTCAACCACCACTCCGGGACCCGTCCAACCATA ArgEndThrTrpMetLysLeuValValArgProTrpAlaGlyTrpTyr 20 30 GlnGlyGluArgGlyEndSerTrpTrpEndGlyProGlyGlnValGlyIle LysValAsnVALAspGluValGlyGlyGluAlaLeuGlyARGLeuValSerArgEndThrTrpMetLysLeuValValArgProTrpAlaGlyTrpTyr GlnGlyGluArgGlyEndSerTrpTrpEndGlyProGlyGlnValGlyIle - APAIB page 248 The end of exon 1 & start of intron 1 CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTAT a: b: c: AspArgGluAspSerTrpValSerAspArgHisEndLeuSerLeuProIle ThrGluLysThrLeuGlyPheLeuIleGlyThrAspSerLeuCysLeuLeuGlnArgArgLeuLeuGlyPheEndEndAlaLeuThrLeuSerAlaTyr - APAIB page 249 The end of intron 1 & start of exon 2 a: b: a: c: b: c: TGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCTTTGGACCCAG 351 ATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGT ---------+---------+---------+---------+---------+400 ACCAGATAAAAGGGTGGGAATCCGACGACCACCAGATGGAAACCTGGGTC 501 ---------+---------+---------+---------+---------+550 31 TACCGGACCGAGTGGACCTGTTGGAGTTCCCGTGGAAACGGTGTGACTCA GlyLeuPheSerHisProEndAlaAlaGlyGlyLeuProLeuAspProGlu80 ValTyrPheProThrLeuArgLEULeuValValTyrProTrpThrGln TrpProGlySerProGlyGlnProGlnGlyHisLeuCysHisThrGluEndTrpSerIlePheProProLeuGlyCysTrpTrpSerThrProGlyProArg -GlyLeuAlaHisLeuAspASNLeuLysGlyThrPheAlaThrLeuSer MetAlaTrpLeuThrTrpThrThrSerArgAlaProLeuProHisEndVal - APAIB page 250 The end of exon 2 & start of intron 2 a: b: a: c: b: c: AGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGG 401 GAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAG ---------+---------+-...
View Full Document

Ask a homework question - tutors are online