Atggtgcacctgactcctgaggagaagtctgccgttactgccctgtgggg

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: +---------+---------+200 TACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCC 0 10 245 TGTAAACGAAGACTGTGTTGACACAAGTGATCGTTGGAGTTTGTCTGTGG a: IleCysPheEndHisAsnCysValHisEndGlnProGlnThrAspThr b: ThrPheAlaSerAspThrThrValPheThrSerAsnLeuLysGlnThrPro c: HisLeuLeuLeuThrGlnLeuCysSerLeuAlaThrSerAsnArgHisHisa: IleCysPheEndHisAsnCysValHisEndGlnProGlnThrAspThr APAIB page 248 The start codon b: ThrPheAlaSerAspThrThrValPheThrSerAsnLeuLysGlnThrPro c: HisLeuLeuLeuThrGlnLeuCysSerLeuAlaThrSerAsnArgHisHis- a: b: c: a: b: c: ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG 151 ---------+---------+---------+---------+---------+200 TACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCC ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG 0 10 151 ---------+---------+---------+---------+---------+200 METValHisLeuThrProGluGluLysSerALAValThrAlaLeuTrpGly TACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCC T 0 rpCysThrEndLeuLeuArgArgSerLeuProLeuLeuProCysGlyAla10 GlyAlaProAspSerEndGlyGluValCysArgTyrCysProValGly METValHisLeuThrProGluGluLysSerALAValThrAlaLeuTrpGly TrpCysThrEndLeuLeuArgArgSerLeuProLeuLeuProCysGlyAlaGlyAlaProAspSerEndGlyGluValCysArgTyrCysProValGly - a: b: c: a: b: c: 201 ---------+---------+---------+---------+---------+250 GTTCCACTTGCACCTACTTCAACCACCACTCCGGGACCCGTCCAACCATA CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTAT 20 30 201 ---------+---------+---------+---------+---------+250 LysValAsnVALAspGluValGlyGlyGluAlaLeuGlyARGLeuValS...
View Full Document

Ask a homework question - tutors are online