{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

What kind of mutation is g197 a

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: PheAlaSerAspThrThrValPheThrSerAsnLeuLysGlnThrPro Frame-shift HisLeuLeuLeuThrGlnLeuCysSerLeuAlaThrSerAsnArgHisHisE. Major, non-frameshift, change in many amino acids ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG 151 ---------+---------+---------+---------+---------+200 TACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCC 0 10 METValHisLeuThrProGluGluLysSerALAValThrAlaLeuTrpGly - TrpCysThrEndLeuLeuArgArgSerLeuProLeuLeuProCysGlyAla GlyAlaProAspSerEndGlyGluValCysArgTyrCysProValGly - TGTAAACGAAGACTGTGTTGACACAAGTGATCGTTGGAGTTTGTCTGTGG IleCysPheEndHisAsnCysValHisEndGlnProGlnThrAspThr iClicker Question 5: ThrPheAlaSerAspThrThrValPheThrSerAsnLeuLysGlnThrPro HisLeuLeuLeuThrGlnLeuCysSerLeuAlaThrSerAsnArgHisHis- Another kind of beta- zero- thalassemia is caused by the mutation T245C. What kind of mutation is T245 C? ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG A. Silent 151 ---------+---------+---------+---------+---------+200 B. TACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCC Minor missense (~similar properties) 0 10 C. METValHisLeuThrProGluGluLysSerALAValThrAlaLeuTrpGly Major missense (very different properties) rpCysThrEndLeuLeuArgArgSerLeuProLeuLeuProCysGlyAlaD. TFrame-shift GlyAlaProAspSerEndGlyGluValCysArgTyrCysProValGly E. Major, non-frameshift, change in many amino acids CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTAT 201 ---------+---------+---------+---------+---------+250 GTTCCACTTGCACCTACTTCAACCACCACTCCGGGACCCGTCCAACCATA 20 30 LysValAsnVALAspGluValGlyGlyGluAlaLeuGlyARGLeuValSerArgEndThrTrpMetLysLeuValValArgProTrpAlaGlyTrpTyr GlnGlyGluArgGlyEndSerTrpTrpEndGlyProGlyGlnValGlyIle -...
View Full Document

{[ snackBarMessage ]}

Ask a homework question - tutors are online