{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

What kind of mutation is t245 c

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: LeuProCysGlyAlaD. TFrame-shift GlyAlaProAspSerEndGlyGluValCysArgTyrCysProValGly E. Major, non-frameshift, change in many amino acids CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTAT 201 ---------+---------+---------+---------+---------+250 GTTCCACTTGCACCTACTTCAACCACCACTCCGGGACCCGTCCAACCATA 20 30 LysValAsnVALAspGluValGlyGlyGluAlaLeuGlyARGLeuValSerArgEndThrTrpMetLysLeuValValArgProTrpAlaGlyTrpTyr GlnGlyGluArgGlyEndSerTrpTrpEndGlyProGlyGlnValGlyIle -...
View Full Document

{[ snackBarMessage ]}

Ask a homework question - tutors are online